Bulimina marginata

Order “Rotaliida” > Family “Incertae sedis” > Genus “Bulimina

Original description Orbigny, A. D`., 1826, Ann. Scien. Nat., 7, 245-314
Description Höglund, H., 1947, Zoologiska Bidrag fran Uppsala, 26

General description

Ovate test, tapering, numerous inflated chambers arranged in a triserial spiral that is somewhat twisted, lower chamber margins usually extending out from the preceding, might be armed with spines of varying length.

Representative pictures

Bulimina marginata

Specimens

Specimen 3599

Species Rotaliida > Incertae sedis > Bulimina > Bulimina marginata
Isolate number 3599
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on May 2002
Location Oslofjord, Norway

Barcode sequences

SSU partial

>Bulimina marginata | genomic DNA | 3599 | taxon:313259 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattagcacttagcttcggcgacgtgttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcctaattgcgtttcaccaagggcctataattttacgtgtgttgcggcaccttgacccctntttttttaaagagcgcgtgtcttggtttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacgtgcatatgtaatttttttaaattgctttgcgcgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagaccatttattcaccttcgggtgctttaaatgtgttttctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcgaagttatttttataacatacgcacctgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatc

See sequence on NCBI

SSU partial

>Bulimina marginata | genomic DNA | 3599 | taxon:313259 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacattacactctcacgcacacacacacacacacacacacgagattcgttacggtagtaacaatttcagcgtgaatcacctttacacagtgaatcactgaaattacccattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtcatttcaaacaggagagagaatttattttttcccgcctgctttgaattgcatactatcacacatgctgattgttgcaatcattcgatttctctgtatcgcttattctcaaaggacatgcgttacaccgtgacaattttcttttatggataactcagggaaagtttggctaatacgtacgagtatcacacacacacacacactcgcacacattttatgattcgctctcacgtggcgacgtatctttttctctcacacacactacaccccgaatcgattacrtaccgcgagagatcacacagtgtttcattttttatgtgtctgcaacacatcaactactcarcactcaatggtaaactttggccgcgttcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtgacttcggtcacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatttattatcattttgtattactattgcgttatacaacaatttacaacacacacacactagatgtgatgtaatatatatagcactatattttaattctgtcacctacacacagaaatacatccttgttcgttgttttttttcacgtaacgcaaaaagtcaatttcttgattttatgtttttactgaggcagtggcaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgttcacgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaaacttgagtgaattctatttcatctcgattttgtgagtaacttacgcgtaactttttttttatagattcgcacctcgcgtctctttagatttttaattttatgcgttcgacgctgtttagaacacacgctaaattttttacacggcactcactcgcctttagaatttattctcatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcagccttaggaagaaattccactgcatacgttctcgcacacacacacacacaccgcagctcatatgcaggcgacgcacatgttaataccgccgcgtagatttttatttcttcttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattatattttttttatgcacacagcacacagcatacacacacacacacacatactgtgtcgccccgtgtctcaaaaaatatatacactttacaatgaagaacgaagggttgggagatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttctcgtaaattgcaaatttcctcagctacaaaatgaattggcttgagctcgtattattcgtaatacgctcgcctcactattttcgtacggtctcgatggacgtttcatttatatttttttgcgtgtaagcattatgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactatgtcatactgcccgcagcgtatgccttcgggcatttcgttctgtcgtgtgtagttgacaattttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccttccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattagcacttagcttcggcgacgtgttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcctaattgcgtttcaccaagggcctataattttacgtgtgttgcggcaccttgacccctctttttttaaagagcgcgtgtcttggtttgcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacgtgcatatgtaatttttttaaattgctttgcgcgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagaccatttattcaccttcgggtgctttaaatgtgttttctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcgaagttatttttataacatacgcacctgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen 523

Species Rotaliida > Incertae sedis > Bulimina > Bulimina marginata
Isolate number 523
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 1997
Location Sweden, Tjärnö

Barcode sequence

SSU partial

>Bulimina marginata | genomic DNA | 523 | taxon:313259 | small subunit ribosomal RNA ttaccgggtccggcacactgaggattgacaggcaatattagcacttagcttcttgcgacgggttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaccaagggcctataattttacgtgtgttgcggcactttgacccctctttttttaaagagcgcgggtcttggttngcttagctcgcacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacgggcatatgnaattttttnaaattgctttgcgcgcaaaaaggntttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggnctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcaggagcatctcattttttacacaccgcatacgcgagaccatttattcaccttcgggtgctttaaatgtgttttctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcgaagttatttttataacatacgcacctgcctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctg

See sequence on NCBI