Arnoldiellina fluorescens

Order “"monothalamids"” > Family “Clade I” > Genus “Arnoldiellina

Original description Apothéloz-Perret-Gentil L., Holzmann M., Pawlowski J., 2013, European Journal of Protistology, 49, 210-216 (1.09 MB)

General description

Test free, monothalamous, fusiform. The length is 3-5 times the width. Transparent organic wall that increases in thickness around the single terminal aperture. The aperture is funnel-shaped with a tubular extension inside the theca.

Representative pictures

A.fluorescens

Specimens

Specimen 14006

Species "monothalamids" > Clade I > Arnoldiellina > Arnoldiellina fluorescens
Isolate number 14006
Collector Laure Apothéloz-Perret-Gentil
Identifier Laure Apothéloz-Perret-Gentil
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATTTGACTCAACGCGGGAAATYTTACCGGGTCCGGACACACTGAGGATTGACAGGTTCTTTAACAAAAAAAATAATATATTTATATATTTTTTTATTTTGTTATTAAATATGCTAGTCCTTTCATGATTGTGTGATAGGTGGTGCATGGCCGTTYTTAGTTCGTGGAGTGATCTGTYTGCTTAATTGCGTTTCATTAATTAGTCGCTGATTTCATCAATAGTTGTTTAAACATTTTGTCACATATAACTTTTTTTTTTATTATTATAAAAATTTTAGTTTGTGCAATTATGTTTCAACTTAAAGGTGAACAGTGACACGAAGGCAACGAACGTGACCGCAACCTCTTGTTGCCTCCTTTCTTATAAAATTATATATATTTTTTTATATATTTTTTTTTAWAAGTTTATATATTTATTTTTTTATTTTAAAAAAATAAAATCGGAGGCTTTTCATTTTTTCATATTAWATTATTTTATTATTATTTTKGATTGCYCTTTTATTWAATTATAATKGGGTAGTTTTTAGATTTWATWAAAAATAWAATTTGAAATGAAAACAACTAGAGGGACCGCTAGAGTATTTTTTTAAAACAGAGGAAGGTTGCGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGCTGCACACGTGCTACAATGATTATTGCAGTGGCATCTAATACTAAAGTTTTTTTATTATTTTTTTATATTTTATTTTTAAAATATATTTTTATAATAAAATCTTTAAACCTGCTTCGAAAGTTTAGCAGGCAATCAATTGGAAGTAATGATTTCCCCTTTTCTGCTTTATATACATATTTTTTAAATATTATATTCTGTTCAGAATTGACGCACTTTTATATGCTTTATTTAATTGATTTTTTATAATATTTTTTTAATTTTATATAAAAATACTTTTAATTAAATGCATGTGCCCTAATTCTTTTAAATTTTTATATGTATATTTTTTTATATATATATATATAATTTAAAATAAAATTCGTGGTGGGGACARACCATTGCTAATTGTTGGWCTCGGWCTTAACTAGGAATGCCTTGTACGGGTCTT

See sequence on NCBI

Specimen 14007

Species "monothalamids" > Clade I > Arnoldiellina > Arnoldiellina fluorescens
Isolate number 14007
Collector Laure Apothéloz-Perret-Gentil
Identifier Laure Apothéloz-Perret-Gentil
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATTTGACTCAACGCGGGAAATCTTACCGGGTCCG GACACACTGAGGATTGACAGGTTCTTTAACAAAAAAAATAATATATTTATATATTTTTTTATTTTGTTAT TAAATATGCTAGTCCTTTCATGATTGTGTGATAGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATCT GTCTGCTTAATTGCGTTTCATTAATTAGTCGCTGATTTCATCAATAGTTGTTTAAACATTTTGTCACATA TAACTTTTTTTTTTATTATTATAAAAATTTTAGTTTGTGCAATTATGTTTCAACTTAAAGGTGAACAGKG ACACGAAGGCAACRAACGTGACCGCAACCTCTTGTTGCCTCCTTTCTTATAAAATTATATATATTTTTTT ATATATTTTTTTTTATAAGTTTATATATTTATTTTTTTATTTTAAAAAAATAAAATCGGAGGCTTTTCAT TTTTTCATATTATATTATTTTATTATTATTTTTGATTGCTCTTTTATTTAATTATAANTGGGTAGTTTTT AGATTTTATTAAAAATATAATTTGAAATGAAAACAACTAGAGGGACCGCTAGAGTATTTTTTTAAAACAG AGGAAGGTTGCGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGCTGCACACGTGCTACAATGAT TATTGCAGTGAGCATCTAATACTAAAGTTTTTTTATTATTTTTTTATATTTTATTTTTAAAATATATTTT TATAATAAAATCTTTAAACCTGCTTCGAAAGTTTAGCAGGCAATCAATTGGAAGTAATGATTTCCCCTTT TCTGCTTTATATACATATTTTTTAAATATTATATTCTGTTCAGAATTGACGCACTTTTATATGCTTTATT TAATTGATTTTTTATAATATTTTTTTAATTTTATATAAAAATACTTTTAATTAAATGCATGTGCCCTAAT TCTTTTAAATTTTTATATGTATATTTTTTTATATATATATATATAATTTAAAATAAAATTCGTGGTGGGG ACAGACCATTGCTAATTGTTGGTCTCGGTCTTAACTAGGAATGCCTTGTACGGGTCTTGGTTCAACAAAC CACCCGGAATATGTCCCTGCCCTTTGTACACACCGCCCGTC

See sequence on NCBI

Specimen 14008

Species "monothalamids" > Clade I > Arnoldiellina > Arnoldiellina fluorescens
Isolate number 14008
Collector Laure Apothéloz-Perret-Gentil
Identifier Laure Apothéloz-Perret-Gentil
Habitat soft sediment
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATTTGACTCAACGCGGGAAATCTTACCGGGTCCG GACACACTGAGGATTGACAGGTTCTTTAACAAAAAAAATAATATATTTATATATTTTTTTATTTTGTTAT TAAATATGCTAGTCCTTTCATGATTGTGTGATAGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATCT GTCTGCTTAATTGCGTTTCATTAATTAGTCGCTGATTTCATCAATAGTTGTTTAAACATTTTGTCACATA TAACTTTTTTTTTTATTATTATAAAAATTTTAGTTTGTGCAATTATGTTTCAACTTAAAGGTGAACAGTG ACMCGAAGGCAACRAACGTGACCGCAACCTCTTGTTGCCTCCTTTCTTATAAAATTATATATATTTTTTT ATATATTTTTTTTTATAAGTTTATATATTTATTTTTTTATTTTAAAAAAATAAAATCGGAGGCTTTTCAT TTTTTCATATTATATTATTTTATTATTATTTTTGATTGCTCTTTTATTTAATTATAATTGGGTAGTTTTT AGATTTTATTAAAAATATAATTTGAAATGAAAACAACTAGAGGGACCGCTAGAGTATTTTTTTAAAACAG AGGAAGGTTGCGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGCTGCACACGTGCTACAATGAT TATTGCAGTGAGCATCTAATACTAAAGTTTTTTTATTATTTTTTTATATTTTATTTTTAAAATATATTTT TATAATAAAATCTTTAAACCTGCTTCGAAAGTTTAGCAGGCAATCAATTGGAAGTAATGATTTCCCCTTT TCTGCTTTATATACATATTTTTTAAATATTATATTCTGTTCAGAATTGACGCACTTTTATATGCTTTATT TAATTGATTTTTTATAATATTTTTTTAATTTTATATAAAAATACTTTTAATTAAATGCATGTGCCCTAAT TCTTTTAAATTTTTATATGTATATTTTTTTATATATATATATATAATTTAAAATAAAATTCGTGGTGGGG ACAGACCATTGCTAATTGTTGGTCTCGGTCTTAACTAGGAATGCCTTGTACGGGTCTTGGTTCAACAAAC CACCCGGAATATGTCCCTGCCCTTTGTACACACCGCCCGTC

See sequence on NCBI