Carterina spiculotesta

Order “Textulariida” > Family “Carterinidae” > Genus “Carterina

Original description Carter H.J., 1877, Annals and Magazine of Natural History, London, 4, 470-473
Further reference Hansen H.J., Gronlund H., 1977, Bull. Geol. Soc. Denmark, 26, 147-154
Further reference Deutsch S., Lipps J.H., 1976, Journal of Paleontology, 50, 312-317
Further reference Angell W., 1978, Journal of Paleontology, 52, 182-185

General description

Specimens of this species possess a large white peripheral flange composed of a mass of calcareous spicules similar to that illustrated in the original description of Carterina spiculotesta (Carter, 1877). Tests are trochospiral throughout with chambers increasing rapidly in size. The last whorl comprises only 2-3 chambers. The deep umbilicus may be filled up with a spicular mass that may extend into the peripheral flange. Only the first (about 10) chambers are brownish in color, the other ones are yellowish or white. The spicules are elongated, fusiform, arranged somewhat parallel to the periphery on the spiral side and radial on the umbilical side.

Representative pictures

Carterina spiculotesta

Specimens

Specimen 9632

Species Textulariida > Carterinidae > Carterina > Carterina spiculotesta
Isolate number 9632
Collector Jean-Pierre Debenay
Identifier Jean-Pierre Debenay
Habitat Reef rubble
Depth 8m
Location New Caledonia, Uitoé
Latitude, Longitude -22.1667, 166.1

Barcode sequences

SSU partial

>HG425254.1 Carterina spiculotesta partial 18S rRNA gene, isolate 9632, clone 43 AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATCTGACTCAACGCGGAAAATCTTACCGGGTCCGGACACACTGAGGATTGACAGGTTCATCATCATGTGATGTGTTTTTCACGGAACACATTACATGCACACACAAAAATGCTAGTCCTTTCATGATTATGTGATAGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATCTGTCTGCTTAATTGCGTATCACTTTTAACGTGTATCAAACATATATTCAATATGTACTGACCTTGTTCACGCATGCGTCTATACATTGAGAATATATTTACACGTTGATAGCAACGAACGTGACCGTAATCCCTTGTTGCGATATTCACCTACTCTCACCCCGTGTTAATATCGCTAACTAGGGAGACCGCTGTATTCTTTCTTAAACCAGAGGAAGGTTACGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGCCGCACACGTGCTACACTGATTATTGCAGTGAGTATCTTACTTAACTTGCTATGTGTATGCGTGTATGTTTACATACACAAATACACGCTCAAATAGCCTGCTTCGAAAGTTACCTCGCGGGTAATCAATTAGCAGTAATGATTTTCCATCATACATGCACATTATGTACGTATATTATACCCAGTGTGTGATTTATCACACACTCGTGTGTATAATATTACACGTACGTGCATTTTATCAATTCATGGTGGGGACAGACTATTGTTAATTATTAGTCTCGGTTTCAACTAGGAATGCCTTGTACTGGTTAGTTCAACAAACTACCAGGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCTCTTACCGATGAACTATACTGTGAGTTTATTGGACTCATACATTAAAATTTCCATTTTATGTATGGGAAAAATGCACGAACAGTGTGGTTTAAAGGAAAGAGAAGTCGAACAAGGC

See sequence on NCBI

SSU partial

Other sequence