Spirolina arietinus

Order “Miliolida” > Family “Peneroplidae” > Genus “Spirolina

Original description Batsch, A., I., G., C.,, 1791, Jena
Description Bock, W., D., Lynts, G., W., Smith, S., Wright, R., Hay, W., W., Jones, J., I., 1971, Miami Geological Society Publications, Memoir 1

General description

Peneroplid coiling in early portion but not completely involute, later chambers become uncoiled. red colour in living specimens due to rhodophycean endosymbionts.

Representative pictures

Spirolina arietinus Spirolina arietinus Spirolina arietinus

Specimens

Specimen 875

Species Miliolida > Peneroplidae > Spirolina > Spirolina arietinus
Isolate number 875
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef sediment
Location USA, Florida Keys

Barcode sequence

SSU partial

>Spirolina arietinus | genomic DNA | 875 | marine sediment sample | taxon:577499 | 13 | USA:Florida Keys | Jul-1998 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccgganatattgaggattgacaggcgatatatatcatattcattatgatataataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagattaataataatatataaatatataatttaatattattttatactgttctgccaattatttaattggattttaaagtgaacgtatatatttattaatttatattattatatattaataatgaatgcaacgaacgtgaccgtaaccttttattgctataataatataatatagcataaaattaaaggaaccgctgtcattttatatgttttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatatatattgtagcatattgtgctaataataaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattataaataataatatatatatattattaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatttaagggacttatgtcactttgttgacaaagaaactttaatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI