Virgulinella fragilis

Order “Rotaliida” > Family “Virgulinellidae” > Genus “Virgulinella

Original description Grindell D.S., Collen J.D., 1976, Rev. Espanola de Micropaleontol., 8, 273-278
Further reference Tsuchiya M., Grimm W.G., Heinz P., Stögerer K., Ertan T.K., Collen J., Brüchert V., Hemleben C., Hemleben V., Kitazato H., , 2009, Marine Micropaleontology, 70, 1-2, 8-19

General description

V. fragilis has a calcareous test with a high triserial chamber configuration. Numerous elongated or oval-shaped small pores are visible on the test surface . A narrow, elongated tear-shaped aperture is situated at the inner margin of the ultimate chamber and extends toward the apex. A tooth plate stretches through the chambers and terminates around the aperture. Serrate undulation is developed on the basal end of each chamber. Arched sutural openings with interposed bridges of basal chamber wall are developed in each chamber.

Representative pictures

Specimens

Specimen 624

Species Rotaliida > Virgulinellidae > Virgulinella > Virgulinella fragilis
Isolate number 624
Collector Masashi Tsuchiya
Identifier Masashi Tsuchiya
Habitat soft sediment
Depth 16.7m
Location New Zealand, Wellington Harbor

Barcode sequences

SSU partial

AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATTTGACTCAACGCGGGAAATCTTACCGGGTCCG GACACACTGAGGATTGACAGGCAATATTAATATTTCACAAGTACTTCGGTATCTTTGTCGATTTATTATG TTAAATATGCTAGTCCTTTCATGATTATGTGATAGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATC TGTCTGCTTAATTGCGTTTCACTAAGGATCTATTTATTAACGTGTGTTGCGGCACTTTGACCCCTCATTT TTATTAATGTGCGCGTGTCTTAGTTTGCTTAGCTCACACAATTAGATCCTGAAAGCAACGAACGTGACCG CAACCTCTTGTTGCCTTTATACCAAACATGTTGGTTTTAAAGAATCCTTTTTTTATACCTTCGTGCAAAA AGGCTTTTTAAACTAGAGGGACCGCTGTTATCTTCTTAAACCAGAGGAAGATTGCGGCAATAACAGGTCT GTGATGCCCTTAGATGTTCCGGGCTGCACACGTGCTACAATGATTATTGCAGTGAGCATCTCATTTTTTA CACACCGCATTCGCGAGTCCATTTATTCATCTTCGGGTGCTTTAAATGTGTATCTCTGCGAGCGGTAAAG CCTGCTTCGAGAGTAAGTGGGTAATCAATTAGAAGTAATGATTTCCTTTTTTTATAGCACACATATATAC AGCATTTATGCCCGGGTTGGCCTTGTTGTCAGCTTCTGTGTGTATAGATGTATATCTCAATTAGATTCTT TATGTCTCTTTTTAGATTCTGTATGTGCAATTGTCAATTCGTGGTGGGGACAGACCATTGTTAATTGTTG GTCTCGGTCTTAACTAGGAATGCCTTGTACGGGTCTTTGGTTCAACAAACCACCCGGAATACGTCCCTGC CCTTTGTACACACCGCCCGTCGCTCTTACCGATGGACTTCTCTGTGAGTTTGAGGGACTGGGTATTTTTG CCTATGGAAACTTAAACGAACAGTGTGGTCTAAAGGAAAGAGAAGTCGTAACAAGGCATCGGTAGGTGAA CCTGCAGAAGGATCA

See sequence on NCBI

SSU partial

AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATTTGACTCAACGCGGGAAATCTTACCGGGTCCG GACACACTGAGGATTGACAGGCAATATTAATATTTCACAAGTTACTTCGGTATCTTTTGTCGATTTATTA TGTTAAATATGCTAGTCCTTTCATGATTATGTGATAGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGA TCTGTCTGCTTAATTGCGTTTCACTAAGGATCTATTTATTAACGTGTGTTGCGGCACTTTGACCCCTCAT TTTTATTAATGTGCGCGTGTCTTAGTTTGCTTAGCTCACACAATTAGATCCTGAAAGCAACGAACGTGAC CGCAACCTCTTGTTGCCTTTATACCAAACATGTTGGTTTTAAAAATTCTTTTTTATACCTTCGTGCAAAA AGGCTTTTTAAACTAGAGGGACCGCTGTTATCTTCTTAAACCAGAGGAAGATTGCGGCAATAACAGGTCT GTGATGCCCTTAGATGTTCCGGGCTCCACACGTGCTACAATGATTATTGCAGTGAGCATCTCATTTTTTA CACACCGCATTCGCGAGTCCATTTATTCATCTTCGGGTGCTTTAAATGTGTATCTCTGCGAGCGGTAAAG CCTGCTTCGAGAGTAAGTGGGTAATCAATTAGAAGTAATGATTTCCTTTTTTTATAGCACACATATATAC AGCATTTATGCCCGGGTTGGCCTTGTTGTCAGCTTCTGTGTGTATAGATGTATATCTCAATTAGATTCAT TATGTCTCTTTTTAGATTCTGTATGTGCAATTGTTAATTCATGGTGGGGACAGACCATTGTTAATTGTTG GTCTCGGTCTTAACTAGGAATGCCTTGTACGGGTCTTTGGTTCAACAAACCACCCGGAATACGTCCCTGC CCTTTGTACACACCGCCCGTCGCTCTTACCGATGGACTTCTCTGTGAGTTTGAGGGACTGGGTATTTTTG CCTATGGAAACTTAAACGAACAGTGTGGTCTAAAGGAAAGAGAAGTCGTAACAAGGCATCGGTAGGTGAA CCTGCAGAAGGATCA

See sequence on NCBI

SSU partial

AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATTTGACTCAACGCGGGAAATCTTACCGGGTCCG GACACACTGAGGATTGACAGGCAATATTAATATTTCACAAGTACTTCGGTATCTTTGTCGATTTATTATG TTAAATATGCTAGTCCTTTCATGATTATGTGATAGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATC TGTCTGCTTAATTGCGTTTCACTAAGGATCTATTTATTAACGTGTGTTGCGGCACTTTGACCCCTCATTT TTATTAATGTGCGCGTGTCTTAGTTTGCTTAGCTCACACAATTAGATCCTGAAAGCAACGAACGTGACCG CAACCTCTTGTTGCCTTTATACCAAACATGTTGGTTTTAAAGAATCCTTTTTTTATACCTTCGTGCAAAA AGGCTTTTTAAACTAGAGGGACCGCTGTTATCTTCTTAAACCAGAGGAAGATTGCGGCAATAACAGGTCT GTGATGCCCTTAGATGTTCCGGGCTGCACACGTGCTACAATGATTATTGCAGTGAGCATCTCATTTTTTA CACACCGCATTCGCGAGTCCATTTATTCATCTTCGGGTGCTTTAAATGTGTATCTCTGCGAGCGGTAAAG CCTGCTTCGAGAGTAAGTGGGTAATCAATTAGAAGTAATGATTTCCTTTTTTTATAGCACACATATATAC AGCATTTATGCCCGGGTTGGCCTTGTTGTCAGCTTCTGTGTGTATAGATGTATATCTCAATTAGATTCTT TATGTCTCTTTTTAGATTCTGTATGTGCAATTGTCAATTCATGGTGGGGACAGACCATTGTTAATTGTTG GTCTCGGTCTTAACTAGGAATGCCTTGTACGGGTCTTTGGTTCAACAAACCACCCGGAATACGTCCCTGC CCTTTGTACACACCGCCCGTCGCTCTTACCGATGGACTTCTCTGTGAGTTTGAGGGACTGGGTATTTTTG CCTATGGAAACTTAAACGAACAGTGTGGTCTAAAGGAAAGAGAAGTCGTAACAAGGCATCGGTAGGTGAA CCTGCAGAAGGATCA

See sequence on NCBI