Androsina lucasi

Order “Miliolida” > Family “Soritidae” > Genus “Androsina

Original description Levy, A., 1977, Bull. Cent. Rech. Explor.-Prod. Elf-Aquitaine, 393-449
Further reference Hallock, P., Peebles, W. M., 1993, Mar. Micropal., 277-292
Further reference Holzmann M., Hohenegger J., Hallock P., Piller W.E., Pawlowski J., 2001, Mar. Micropal., 43, 57-74 (602 KB)
Further reference Pawlowski , J., Holzmann, M., Fahrni, J., Hallock, P., 2001, J. Eukaryot. Microbiol., 48, 362-367 (598 KB)

General description

Tests in Androsina are planispirally coiled and involute in early stages, later chambers become peneropliform, then flabelliform and finally broadly arched but not annular. The interior of chambers is divided by pillars. Living specimens appear brownish - greenish and harbour chlorophycean endosymbionts.

Representative pictures

Androsina lucasi Androsina lucasi; living specimen

Specimens

Specimen 850

Species Miliolida > Soritidae > Androsina > Androsina lucasi
Isolate number 850
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Dwarf mangrove forests
Depth 2-10cm
Location USA, Florida Keys

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggtgatagtatatacttattaagagtatatgcataaatatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataatttattgttctgcctatatttatataggatttaaagtgaacatattataaatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataattattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatattattatatgtatttattacattcaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattatttataaatatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaatataatttatgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Androsina lucasi | genomic DNA | 850 | taxon:128069 | USA: Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcaatatatagataacttaaatataagttacttggataactaagggaaagtttggctaatacgtttaaatgtattataataaatacatatgcatataataatattgcaacatgatagatattatataaaaataagatatattttattatatcttataagagcagactttataatattttaattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgttataataaacttaattaatatataataattaattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtccctttataatatattntatattattttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatataataatttcaagtaacatatttatyatattatttgaattttcaagtggagggcaagnnnnnnnnnnnnnnccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataaactctcaatactgtgaacaaaccagagtgtataaaacatgttaatattaatattattagcaatgaatgttttatcatggaatattgcatataatatttttgtcgatggaggtagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtatttttacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatattatactccttcaactaattaacattattttatatatgattgagtatttattttactctcatattaaatatatatattgatattttgataaaataaaatatcattatatgtactttgcgctcatataattatataggtgagatgtaagcattatagatgattaatatgtatagtatttatatattattacattattatgaatcttatataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggtgatagtatatacttattaagagtatatgcataaatatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataatttattgttctgcctatatttatataggatttaaagtgaacatattataaatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataattattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatattattatatgtatttattacattcaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattatttataaatatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaatataatttatgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI