Broeckina sp.

Order “Miliolida” > Family “Soritidae” > Genus “Broeckina

Description Levy, A., 1977, Bull. Cent. Rech. Explor.-Prod. Elf-Aquitaine, 393-449
Further reference Hallock, P., Peebles, W. M., 1993, Mar. Micropal., 277-292
Further reference Holzmann M., Hohenegger J., Hallock P., Piller W.E., Pawlowski J., 2001, Mar. Micropal., 43, 57-74 (602 KB)
Further reference Pawlowski , J., Holzmann, M., Fahrni, J., Hallock, P., 2001, J. Eukaryot. Microbiol., 48, 362-367 (598 KB)

General description

Discoidal test with annular chambers that have internal subdivisions. Living specimens are green due to chlorophycean endosymbionts. Occurence: Carribean Sea.

Representative pictures

Broeckina sp. Broeckina sp., living specimen

Specimens

Specimen 835

Species Miliolida > Soritidae > Broeckina > Broeckina sp.
Isolate number 835
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef sediment
Depth 30m
Location USA, Florida Keys, Conch reef
Latitude, Longitude 24.57, -80.27

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgactggcgatagtttattattctttagttaataataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatacattaatatttagttctgccttaatttatatttcggatttaaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatttaattatatatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatataaaataatattttaatatattaataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaacattttaaaaatatataaattattttattgtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggaattatatattttattatttatgacaaacttatatacataatatgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Broeckina sp. 835 | genomic DNA | 835 | taxon:128056 | USA: Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttagcatagttatagagatatagtttagttttggataactaagggaaagtttggctaatacgtttttaaaatgttattaatacacatttatgcatataataatattaattgcaacatgatagatattatataaatattttattcatttatttgaatataatatagagcagactttatatttattttaatataaagcatgtcaaacaaacatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgtatatattgaggcagtgacaagctgtaaagatttaatatattaattaagataacatttggaattgtcccttaataatatttatattattttggttgataatataccaatgttataaaatattaaatttgaatgcggtgaatataataatttcaagtaacatgtataaaatattaatattttatatgttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaaaataaaatatataataatatcaatactgtgaacaaaccagagtgtataaaacatgtaatattaattattagcaatgaatgttttatcatgggatattgcttatatatttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtactattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatatatataatattcattctcaactaataattaatatgattgagttatattattactctcatataaataaatgttgtttttgttaataaaacatgtattgattatatgtactttgcgctcatataattatataggtgagatgtaagcattattgatgattaatatactacatatataatatgtaagtattattataattcaaatataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgactggcgatagtttattattctttagttaataataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatatacattaatatttagttctgccttaatttatatttcggatttaaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataaataatatttaattatatatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatataaaataatattttaatatattaataaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaacattttaaaaatatataaattattttattgtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggaattatatattttattatttatgacaaacttatatacataatatgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI