Cyclorbiculina compressa

Order “Miliolida” > Family “Soritidae” > Genus “Cyclorbiculina

Original description Orbigny, A.D., , 1839, 2
Description Crapon de Caprona d`Ersu, A., 1983, Rev. Paléobiol., 347-390
Further reference Hallock, P., Peebles, W. M., 1993, Mar. Micropal., 277-292
Further reference Holzmann M., Hohenegger J., Hallock P., Piller W.E., Pawlowski J., 2001, Mar. Micropal., 43, 57-74 (602 KB)
Further reference Pawlowski , J., Holzmann, M., Fahrni, J., Hallock, P., 2001, J. Eukaryot. Microbiol., 48, 362-367 (598 KB)

General description

Test growth in Cyclorbiculina compressa starts with planispiral and involute chambers that rapidly increase in size and finally become annular.Chambers are divided by partitions. Living specimens possess a green colour due to chlorophycean endosymbionts.

Representative pictures

Cyclorbiculina compressa Cyclorbiculina compressa Cyclorbiculina compressa; living specimen Cyclorbiculina compressa Cyclorbiculina compressa

Specimens

Specimen 878

Species Miliolida > Soritidae > Cyclorbiculina > Cyclorbiculina compressa
Isolate number 878
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Location USA, Florida Keys

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttattatacttagttgtatagtaagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacattaatattttagttctgccaatattatattggatttaaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataaatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatattacattaataattatattaatacaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattataaaaataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatttaagggattataatatatattaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Cyclorbiculina compressa | genomic DNA | 878a | taxon:128071 | USA: Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatagatagtatctataaatatataatattttggataactaagggaaagtttggctaatacgtttaaaatgtatttaataatacatatgcatataataatattgcaacatgatagatattatataaattaaaatactttaatatgtatttttaatagagcagactttataatatatattattattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgtatttttattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtccctttataatattttatattattttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatttaataatttcaagtaacatgtatattttatatgttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaattatattaaccaatactgtgaacaaaccagagtgtataaaacatgtaatattttatattatgcaatgaatgttttatcatggaatattgctataatatttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgtatatttaaccatattaaaatatgattgagtttattaaattatatatatactctcatataataatattataatattatatgtactttgcgctcatataataatataggtgagatgtaagcattattggtttacaatatacttatatattatttaattaatatataatgtattattgtaatcctaaattataaatataatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttattatacttagttgtatagtaagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacattaatattttagttctgccaatattatattggatttaaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataaatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatattacattaataattatattaatacaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattattataaaaataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatttaagggattataatatatattaaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI