Laevipeneroplis bradyi

Order “Miliolida” > Family “Soritidae” > Genus “Laevipeneroplis

Original description Cushman, J. A., 1930, Ocean. Bull. US Nat. Mus., 104, 1-79
Further reference Hallock, P., Peebles, W. M., 1993, Mar. Micropal., 277-292
Further reference Holzmann M., Hohenegger J., Hallock P., Piller W.E., Pawlowski J., 2001, Mar. Micropal., 43, 57-74 (602 KB)
Further reference Pawlowski , J., Holzmann, M., Fahrni, J., Hallock, P., 2001, J. Eukaryot. Microbiol., 48, 362-367 (598 KB)
Description Gudmundsson, G., 1994, Micropaleontology, 40, 101-155
Revision Seiglie, A., G., Grove, K., Rivera, A., J., 1976, Ecol. Geol. Helv., 70, 855-883

General description

Laevipeneroplis bradyi have planispiral tests with chambers that are partially evolute in early stages and later become flaring. Living specimens show a bright green colour due to chlorophycean endosymbionts.

Representative pictures

Laevipeneroplis bradyi Laevipeneroplis bradyi; living specimens

Specimens

Specimen 825

Species Miliolida > Soritidae > Laevipeneroplis > Laevipeneroplis bradyi
Isolate number 825
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef rubble
Location USA, Florida Keys

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggtgatagtttatatttttttaaaaaatataagcataaatatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttatatacaattaatattttagttctgccttatatttttaaggatttttaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatatattataatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatattttaaataaatacattaatatatattattattgtattataattaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgatttataataaaaatataataactaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttttaatatattttattatatatatagaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Laevipeneroplis bradyi | genomic DNA | 825 | taxon:128065 | USA: Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttagtatagtagtacacatgaatagttataatttggataactaagggaaagtttggctaatacgtttaattttttaaaaattaacatataataatattacaacatgatagatattatataaatattataaacactttattgtgttttaaaatatagagtagactttataataattataattataaagcatgtcaaacaaacatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgagaaaacatgatattgaggcagtaacaagctgtaaagattcaatatattaattaagataacatttggaattgtccctttataatatttttataaatattattttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatttaataatttcaagtaacatgtataaaataattaatattttatatattatctgaatattcaagtggagggcaagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngctcgtagttggattgaatatatattataacattttatttgtttttcaatactgtgaacaaaccagagtgtataaaacatgtaatattaattattatgcaatgaatgttttatcatgggatattgcatatataattaaaaattaatatcgatgaagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattatactttttgtttatttacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgaatattattttatataattattcattatatattcttcaacttaattaaataatatttgattgagtataattttaatatactctcatataattatttttgttgtattatttaaataaataattaatattttaaatataattgattatatgtactttgcgctcatataataatataggtgagatgtaagcattattgatgaataattattttatatattntattatatataattaatatattataaatcaaattaataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaannnnnnnnnnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggtgatagtttatatttttttaaaaaatataagcataaatatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttatatacaattaatattttagttctgccttatatttttaaggatttttaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatatattataatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatattttaaataaatacattaatatatattattattgtattataattaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgatttataataaaaatataataactaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttttaatatattttattatatatatagaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI