Laevipeneroplis karreri

Order “Miliolida” > Family “Soritidae” > Genus “Laevipeneroplis

Original description Wiesner, H.,, 1923; Prag-Bubenec, 1-113
Description Cimerman, F., Langer, M., , 1991, 30, Academia Scientiarum et Artium Slovenica Classis IV: Historia Naturalis, 1-119

General description

Early chambers are planispirally enrolled, later chambers become flabellate and increase in breadth. Living specimens have a green colour due to chlorophycean symbionts.

Representative pictures

Laevipeneroplis karreri_6669

Specimens

Specimen 6669

Laevipeneroplis karreri_6669 Laevipeneroplis karreri_6669
Species Miliolida > Soritidae > Laevipeneroplis > Laevipeneroplis karreri
Isolate number 6669
Collector Beatrice Lecroq
Identifier Maria Holzmann
Collected on September 2006
Habitat soft sediment
Location Adriatic Sea, Mavarstica, Ciovo, Croatia

Barcode sequence

SSU partial

aagggcaccacaagaacgcctggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttatatttttatataaatataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacacatttaatattttagttctgccagagatggatttaaagtgaacaatattattgttataatattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatatattatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaactattattgtagtatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaagagaagggatttatattattaaaataacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Laevipeneroplis karreri | genomic DNA | 6669 | marine sediment sample | taxon:577496 | Croatia:Mavarstica | 27-Sep-2006 | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatagattatcttaatataatatatttggataactaagggaaagtttggctaatacgttttaaatgtatttttaataatacatatgcatataataatattgcaacatgatagatattatataaaatgatatatttaatatatcataagagcagactttatatttttttttaaatataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgagaaaactcaatattaattgaggcagtgacaagctgtaaagatttaatatattaattaagataacatttggaattgtccctttataatattttatattattttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatatataatttcaagtaacatgtatttctgacaaaatatgttatctgaattttcaagtggagggcaagtctggtgcagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataataatttgtagttaatactgtgaacaaaccagagtgtataaaacatgttaatattaatattaagcaatgaatgttttatcatggaatattgctataatatttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattatattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgatgaaatataaatatgattgagtatattattagtactctcataatataatagtattatgattatatgtactttgggctcatataataatataggtgagatgtaagcattatagatgatcaatatatattatttaaatataatatattattgtaattcttaattataaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctagggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcctggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttatatttttatataaatataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacacatttaatattttagttctgccagagatggatttaaagtgaacaatattattgttataatattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatatattatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaactattattgtagtatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaagagaagggatttatattattaaaataacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 6670

Laevipeneroplis karreri_6670; juvenile specimen
Species Miliolida > Soritidae > Laevipeneroplis > Laevipeneroplis karreri
Isolate number 6670
Collector Beatrice Lecroq
Identifier Maria Holzmann
Collected on September 2006
Habitat soft sediment
Location Adriatic Sea, Mavarstica, Ciovo, Croatia

Barcode sequence

SSU partial

>Laevipeneroplis karreri | genomic DNA | 6670 | marine sediment sample | taxon:577496 | 13 | Croatia:Mavarstica | 27-Sep-2006 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttatatttttatataaatataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccactcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacacatttaatattttagttctgccagagatggatttaaagtgaacaatattattgttataatattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatatattatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaactattattgtagtatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaagagaagggatttatattattaaaataacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI