Laevipeneroplis proteus

Order “Miliolida” > Family “Soritidae” > Genus “Laevipeneroplis

Original description Orbigny, A.D., , 1839, 2
Further reference Hallock, P., Peebles, W. M., 1993, Mar. Micropal., 277-292
Further reference Holzmann M., Hohenegger J., Hallock P., Piller W.E., Pawlowski J., 2001, Mar. Micropal., 43, 57-74 (602 KB)
Further reference Pawlowski , J., Holzmann, M., Fahrni, J., Hallock, P., 2001, J. Eukaryot. Microbiol., 48, 362-367 (598 KB)
Description Gudmundsson, G., 1994, Micropaleontology, 40, 101-155
Description Seiglie, A., G., Grove, K., Rivera, A., J., 1976, Ecol. Geol. Helv., 70, 855-883

General description

Early chambers are planispiral and involute, later ones are more or less flaring. Hallock and Peebles (1993) state that this species is morphologically very variable. Chlorophyte symbionts lead to a green colour in living specimens.

Representative pictures

Laevipeneroplis proteus Laevipeneroplis proteus; living specimen

Specimens

Specimen 876

Species Miliolida > Soritidae > Laevipeneroplis > Laevipeneroplis proteus
Isolate number 876
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Reef rubble
Location USA, Florida Keys

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttatattattttataaaatataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacacatttaatattttagttctgccagaaatggatttaaagtgaacatatattattgttataatattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatatattatatataataatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaactattattgtagtatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaagagaagggatttatattattaaaataacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Laevipeneroplis proteus | genomic DNA | 876 | taxon:128066 | USA: Florida keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatagattatcttaatataatatatttggataactaagggaaagtttggctaatacgttttaaatgtatttaataatacatatgcatataataatattattgcaacatgatagatattatataaaatgatatatattatcataagagcagactttataataataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgagaaaacacaatattaattgaggcagtgacaagctgtaaagatttaatatattaattaagataacatttggaattgtccctttataatattttatattattttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatataataatttcaagtaacatgtattttttgaatatgttatctgaattttcaagtggagggcaagnnnnnnnnnnnnnnccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataaaataatatatagttaatactgtgaacaaaccagagtgtataaaacatgttaatattaatattaagcaatgaatgttttatcatggaatattgctattttaataatatctctcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattatattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgatgaaatataaatatgatcgagtatattattagtactctcataatataatagtattatgattatatgtactttgggctcatataataatataggtgagatgtaagcattatagatgatcaatatatattatttaaatataatatattattgtaattcttaattataaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttatattattttataaaatataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacacatttaatattttagttctgccagaaatggatttaaagtgaacatatattattgttataatattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatatattatatataataatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaactattattgtagtatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaagagaagggatttatattattaaaataacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI