Laevipeneroplis spp.

Order “Miliolida” > Family “Soritidae” > Genus “Laevipeneroplis

Further reference Holzmann M., Hohenegger J., Hallock P., Piller W.E., Pawlowski J., 2001, Mar. Micropal., 43, 57-74 (602 KB)
Further reference Pawlowski , J., Holzmann, M., Fahrni, J., Hallock, P., 2001, J. Eukaryot. Microbiol., 48, 362-367 (598 KB)
Description of genus Loeblich, A., J., R., Tappan, H., 1988, vol.1-2, Van Nostrand, Reinhold, New York

General description

Planispiral test with later chambers becoming flaring. Chlorophycean symbionts cause a green colour in living specimens.

Representative pictures

Laevipeneroplis sp. from Guam

Specimens

Specimen 2264

Species Miliolida > Soritidae > Laevipeneroplis > Laevipeneroplis spp.
Isolate number 2264
Collector Xavier Pochon
Identifier Maria Holzmann
Collected on March 2000
Habitat Reef rubble
Location Guam, Gun Beach

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtattattatatattatatatataataatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatattacattaatatttagttctgcctttatggatttaaagtgaacatattatgttaatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataatatttataatatattaatatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatattgtacacataatgatatattatatcattataataaacctatttcgaaagtaaatgggcaatcatttaaaaatcgtgattaatataataactacattaataatacataatattatatattatatataatatatgtagtagtattatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttataatattaatttaataggaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Laevipeneroplis sp. 2264 | genomic DNA | 2264 | taxon:128067 | Guam | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgactttgtaatatatataaataaatgttatctttggataactaagggaaagtttggctaatacgtttaatgtattaataatacacattcatataataataatacaacatgattgatattatataaatataaaatacatttattgtattttaaatagagatgactttataatatttaattattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgttaatatataatataaaaatatacactcaatttaattgaggcagtgacaagctgtaaagattcaatataaaaataaagataacatttggaattgtcgctttataatatttatattatattgcttgataatataccaatgttataaaatattgaatttgaatgcggtgaatgtaataatttcaagtaacatgtataaaatagtaatattttatatgttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataaaatatatacacaacactgtgaacaaatcagagtgtataaaacatgtaatattaattattagcaatgaatgttttatcatgggatattgctaataatatataatataatataaacatgttatgtcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatatagatatataccctcaacttaaatattaatatgattgagtataattatatactctcatatatatattaatgttgataaatatttgattatatgtactttgcgctcatataattatataggtgagatgtaagcattattaatgattaatatacttataatttttaataattataatgtattattatgatttaaatataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtattattatatattatatatataataatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaataaaatatataatattacattaatatttagttctgcctttatggatttaaagtgaacatattatgttaatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataatatttataatatattaatatatagcataaaattaaaggaaccgctgtcattattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatattgtacacataatgatatattatatcattataataaacctatttcgaaagtaaatgggcaatcatttaaaaatcgtgattaatataataactacattaataatacataatattatatattatatataatatatgtagtagtattatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacttataatattaatttaataggaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 2456

Species Miliolida > Soritidae > Laevipeneroplis > Laevipeneroplis spp.
Isolate number 2456
Collector Juan Montoya
Identifier Maria Holzmann
Collected on January 2001
Habitat soft sediment
Location Cuba, Cayo Levisa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagaggcgatagtttatattttatattaatataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacacatttaatattttagttctgccagagatggatttaaagtgaacaatattattgttataatattatataataagtgaatgcaacgaacgtgaccgtacccttttattgctataatatattatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaactattattgtagtatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaagagaagggatttatattattaaaataacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Laevipeneroplis sp. 2456 MH-2008 | genomic DNA | 2456 | marine sediment sample | taxon:577509 | Cuba:Cayo Levisa | 23-Jan-2001 | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatataagtaaatagtttatcttttttggataactaagggaaagtttggctaatacgttttaaatgtatttaataatacatatgcatataataatattattgcaacatgatagatattatataaaatgatatattatgtatatcataagagcagactttatatttttttaaataatataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgagaaaactcaatattaattgaggcagtgacaagctgtaaagatttaatatattaattaagataacatttggaattgtccctttataatattttatattattttggttgataatataccaatgttataaaatattgaattgaatgcggtgaatataataatttcaagtaacacatgtatttgttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataataatatatattttatatattaatactgtgaacaaaccagagtgtataaaacatgttaatattaatattaagcaatgaatgttttatcatggaatattactatttaaataatatttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattatattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgatgaaatataaatatgattgagtatattattagtactctcataatataatagtattatgattatatgtactttgggctcatataataatataggtgagatgtaagcattatagatgatcaatatatattatttaaatataatatattattgtaattcttaattataaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagaggcgatagtttatattttatattaatataagcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatataataatatacacatttaatattttagttctgccagagatggatttaaagtgaacaatattattgttataatattatataataagtgaatgcaacgaacgtgaccgtacccttttattgctataatatattatatagcataaaattaaaggaaccgctgtcataaattatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtaactattattgtagtatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaagagaagggatttatattattaaaataacaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI