Parasorites sp.

Order “Miliolida” > Family “Soritidae” > Genus “Parasorites

Description Levy, A., 1977, Bull. Cent. Rech. Explor.-Prod. Elf-Aquitaine, 393-449
Further reference Holzmann M., Hohenegger J., Hallock P., Piller W.E., Pawlowski J., 2001, Mar. Micropal., 43, 57-74 (602 KB)

General description

Discoidal test with annular chambers that are subdivided into chamberlets. Green colour in living specimens is caused by chlorophycean endosymbionts. Occurence: Indopacific.

Representative pictures

Parasorites sp., Japan, Sesoko, Okinawa Parasorites sp., Japan, Sesoko, Okinawa Parasorites sp., Japan, Sesoko, Okinawa Parasorites sp.

Specimens

Specimen 1634

Species Miliolida > Soritidae > Parasorites > Parasorites sp.
Isolate number 1634
Collector Xavier Pochon
Identifier Xavier Pochon
Collected on July 1999
Habitat soft sediment
Location Guam, Piti

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatatatttattatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataattattagttctgccttaatggatttaaagtgaacatattatatcatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatttttatattttaaatatataatatagcataaaattaaagggaccgctgtctaaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataatacaaatatatattttattatatatttataaaacctatttcgaaagtaaattggtaatcatttaaaaatcgtgattaataaaatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggactattttaatatatatttatagaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Parasorites sp. 1634 | genomic DNA | 1634 | taxon:128073 | Guam | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatatatgatgtaaataagttatttaattattttggataactaagggaaagtttggctaatacgtttaatttttaaatatgtttaattacatatacatataataaaaatcatttttttattgcaacatgatagatattatataaattaaaaatatatatttatttatatattttaaatagaggagactttataattattaattataatattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtactattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgatatttataccttgtattactatactcaatatatatatattaattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtcgctttgtaatattttatatattatattgcttgataatataccaatgttataaaatattgaatctgaatgcggtgaatataataatatcaagtaacatgtataaaatatttaattattttatatgttatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaatatatatataatttatttttatacaatactgtgaacaaatcaaagtgtataaaacatgtaatatattatattatgcaatgaatgttttatcatggaatattgcattaataaaataatattttatattttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgaatatatttattatatatttaatttatatttcttctcaacataattatatatgattgagcgtattatatatactctcatattttaatattaatgttataaaaaaatataatttaaattaaaaaactattgattatatgtactttgagctcatataattatataggtgagatgtaagcattataggagatcaatatatattatgtaaataatatattattgtaatccttaattataaaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatatatttattatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataattattagttctgccttaatggatttaaagtgaacatattatatcatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataatttttatattttaaatatataatatagcataaaattaaagggaccgctgtctaaaattttagtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatataatacaaatatatattttattatatatttataaaacctatttcgaaagtaaattggtaatcatttaaaaatcgtgattaataaaatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggactattttaatatatatttatagaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 312

Species Miliolida > Soritidae > Parasorites > Parasorites sp.
Isolate number 312
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on October 1996
Habitat soft sediment
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatatatattattatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataattattagttctgcctaatatatggatttaaagtgaacatattatatcatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgcattaaagtattgcataaaattaaaggaaccgctgtcattattaatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacatatattaagtataacttaattaaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattataaatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggatttaaataaaatattataaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Parasorites sp. 312 | genomic DNA | 312 | taxon:128075 | Japan: Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttataataagatttagtatcctaattggataactaagggaaagtttggctaatacgtttaataatacatatacatataatatttaatgatagatattatataaattaaaaatacatttatttgtattttaaatagagtagactttatattattataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgattaatatataaccttgtattactgacttttattgaggcagtgacaagctgtaaagattaaatatattaattaagataacatttggaattgtcgctttgtaatattttaatattatattgcttgataatataccaatgttataaaatatttaatttgaatgcggtgaatctaataatttcaagtaacatgtataaaatatttaattattttatatgttatcagaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcnnnnnnnnnnnnnnnnnnnnnnnnnnngctcgtagttggattgaatatattattatacaatactgtgaacaaaccagagtgtataaaacatgtaatatattatattatgcaatgaatgttttatcatggaatattgctaatatattatttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatattttattactctcaactaattaattaaatatgattgagtaatatttattattttactctctatttaaaaaatttatgattcaaaaaatatgattatatgtactttgagctcatataattatataggtgagatgtaagcattataggtgatcaatatatattatattatataatatattattgtaatccttaaaattaaaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaannnnnnnnnnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatatatattattatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataattattagttctgcctaatatatggatttaaagtgaacatattatatcatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgcattaaagtattgcataaaattaaaggaaccgctgtcattattaatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacatatattaagtataacttaattaaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattataaatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggatttaaataaaatattataaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Specimen 483

Species Miliolida > Soritidae > Parasorites > Parasorites sp.
Isolate number 483
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 1997
Habitat soft sediment
Location Great Barrier Reef, Lizard Island

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatatatattattatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataattattagttctgcctaatatatggatttaaagtgaacatattatatcatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctttaaagtattgcataaaattaaaggaaccgctgtcattattaatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacatatattaagtataacttaattaaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattataaatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagagatttaaacataatgttataaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Parasorites sp. 483 | genomic DNA | 483 | taxon:128074 | Australia: Lizard Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgtaattgtattgacttatatatatgttatgaatagttatttggataactaagggaaagtttggctaatacgtttaataataaatatacatataatattttaatgatagatattatataaattaaaaatacatttatttgtattttaaatagagtagactttatattattataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgattaatatataaccttgtattactgacttttattgaggcagtgacaagctgtaaagattaaatatattaattaagataacatttggaattgtcgctttgtaatattttaatattatattgcttgataatataccaatgttataaaatatttaatttgaatgcggtgaatctaataatttcaagtaacatgtataaaatatttaattattttatatgttatcagaattttcaagtggagggcaagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngctcgtagttggattgaatatattattatacaatactgtgaacaaaccagagtgtataaaacatgtaatatattatattatgcaatgaatgttttatcatggaatattgctaatatattatttcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctatttttacatcaaactatgggatttcaattgaatattttattactctcaactaattaattaaatatgattgagaagtaattctctctatttaaatattttatgagataaataattatgattatatgtactttgagctcatataattatataggtgagatgtaagcattataggtgatcaatatatattatattatataatatattattgtaatccttaaaattaaaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaannnnnnnnnnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacccgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatatatattattatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatatataattattagttctgcctaatatatggatttaaagtgaacatattatatcatattattatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctttaaagtattgcataaaattaaaggaaccgctgtcattattaatatgtgttaaaatagagtaagaatacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacatatattaagtataacttaattaaaaacctatttcgaaagtaaatcggtaatcatttaaaaatcgtgattataaatatatatacataattgtatatttaattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagagatttaaacataatgttataaaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI