Bolivina skagerrakensis

Order “Rotaliida” > Family “Bolivinidae” > Genus “Bolivina

Original description Qvale, G., Nigam, R., 1985, J. For. Res., 15, 6-12

General description

Elongated test with subacute to keeled periphery. Frequent in Skagerrak (NE North Sea) and Norwegian fjords.

Representative pictures

Bolivina skagerrakensis, Norway, Oslofjord Bolivina skagerrakensis, Norway, Oslofjord

Specimens

Specimen 12249

Bolivina skagerrakensis_12249 Bolivina skagerrakensis_12249
Species Rotaliida > Bolivinidae > Bolivina > Bolivina skagerrakensis
Isolate number 12249
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Depth 157m
Location Oslofjord, Norway

Barcode sequences

SSU partial

>Bolivina skagerrakensis | genomic DNA | 12249 | taxon:673208 | 1 | Sweden:Oslofjord, 157m depth | Sep-2010 | Roberto Sierra | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA cgcgggaaatcttaccgggtccggacacactgaggattgacaggtaatatcatatatacatacgttcgcgcgtgtgtgtatgtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggtctatttatacgtatacgtatatcgctttaaatattttgaccctatctctctcacgagagatacgcgtgtcttatatattttttatatagcatacactatacattagaccctgaaagcaacgaacgtgaccgcaacctcttgttgctttctcccacacatatatatattattatatacgcgcttcggcacgtgtgtagtgtatgtatattaagaaagcctcgtatatataaatctctaccatctctcacgagatatcagagacgcgtatataaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttttactcacatcgcatgcgtgagtaattttctcatatattctcggatatatcgagtctttctctctacgcgcgattaagnctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctatttttcctgcacaactatatatggcgtatatacccgatatagccttgttgctatattctgtgtgtatgtatgacttttttccatatgtgcaattgtcaattcatggtggggacagnncattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccnnccggaataaatnncccnccccctttgnacacnccncccgtcgctcttaccgatggacttctctgtgagtttgagggactgcctgtgaactcgcgtatcatattaggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Bolivina skagerrakensis | genomic DNA | 12249 | taxon:673208 | 2 | Sweden:Oslofjord, 157m depth | Sep-2010 | Roberto Sierra | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtaatatcatatatacatacgttcgcgcgtgtgtgtatgtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggtctatttatacgtatacgtatatcgctttaaatattttgaccctatctctctcacgagagatacgcgtgtcttatatattttttatatagcatacactatacattagaccctgaaagcaacgaacgtgaccgcaacctcttgttgctttctcccacacatatatatattattatatacgcgcttcggcacgtgtgtagtgtatgtatattaagaaagcctcgtatatataaatctctaccatctctcacgagatatcagagacgcgtatataaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttttactcacatcgcatgcgtgagtaattttctcatatattctcggatatatcgagtctttctctctacgcgcgattaagcctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctatttttcctgcacaactatatatggcgtatatacccgatatagccttgttgctatattctgtgtgtatgtatgacttttttccatatgtgcaattgtcaattcatggtggggacagaccattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgcctgtgaaactcgcgtatcatattaggaaacttaaaaaaacagtgtggtctaaaggaaagagaagtcgaacaaggc

See sequence on NCBI

Specimen 12250

Bolivina skagerrakensis_12250 Bolivina skagerrakensis_12250
Species Rotaliida > Bolivinidae > Bolivina > Bolivina skagerrakensis
Isolate number 12250
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Depth 157m
Location Oslofjord, Norway

Barcode sequence

SSU partial

>Bolivina skagerrakensis | genomic DNA | 12250 | taxon:673208 | 4 | Sweden:Oslofjord, 157m depth | Sep-2010 | Roberto Sierra | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtaatatcatatatctcatatgttctgcgtgtgaggtatgtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggtctatttatacgtatacgtatatcgctttaaatattttgaccctatctctctcacgagagatacgcgtgtcttatatattttttatatagcatacactatacattagaccctgaaagcaacgaacgtgaccgcaacctcttgttgctttctcccacacatatatatattattatatacgcgcttcggcacgtgtgtagtgtatgtatattaagaaagcctcgtatatataaatctctaccatctctcacgagatatcagagacgcgtatataaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttttactcacatcgcatgcgtgagtaattttctcatcataccctcggatatgacgagtctttctctctacgcgcgattaagcctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctatttttcctgcacaactatatatggcgtatatacccgatatagccttgttgctatattctgtgtgtatgtatgacttttttccatatgtgcaattgtcaattcatggtggggacagaccattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagtttgagggactgcctgtgatattcgcgtatcatattaggaaacttaa

See sequence on NCBI

Specimen 12251

Bolivina skagerrakensis_12251
Species Rotaliida > Bolivinidae > Bolivina > Bolivina skagerrakensis
Isolate number 12251
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Depth 157m
Location Oslofjord, Norway

Barcode sequence

SSU partial

>Bolivina skagerrakensis | genomic DNA | 12251 | taxon:673208 | 7 | Sweden:Oslofjord, 157m depth | Sep-2010 | Roberto Sierra | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtaatatcatatatacacgctcgcgttgtaggtgtataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactatagggtctatttatacgtatacgtatatcgctttaaatattttgaccctatctctctcacgagagatacgcgtgtcttatatattttctatagcatacactatacattagaccctgaaagcaacgaacgtgaccgcaacctcttgttgctttctcccacacatatatattatatattgcttcggcgtgtgtagtgtatattaagaaagcctcgtatatataaatctctaccatctctcacgagatatcagagacgcgtatataaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttttactcacatcgcatgcgtgagtaattttctcatatcttcacggatacgagtctttctctctacgcgcgattaagcctacttcgaaagtaagcgggtaatcaattagaagtaatgatttcctatttttcctgcacaactatatatggcgtatatacccgatatagccttgttgctatattctgtgtgtatgtatgacttttttccatatgtgcaattgtcaattcatggtggggacagaccattgtttcaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgcctgtgatatattgcttcaccgtgtgtatcatattaggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcga

See sequence on NCBI