Calcarina defrancii

Order “Rotaliida” > Family “Calcarinidae” > Genus “Calcarina

Original description Cushman, A., J., 1921, U. S. Nat. Mus. Bull. Washington, D. C., USA, 4
Further reference Renema, W., 2008, Mar. Micropal., 68, 286-298

General description

Lenticular test, trochospirally coiled with radial spines. Brownish colour in living individuals due to diatom symbionts.

Representative pictures

Calcarina defrancii, Japan, Ishigaki Calcarina defrancii, Japan, Ishigaki Calcarina defrancii, Japan, Ishigaki

Specimens

Specimen 866

Species Rotaliida > Calcarinidae > Calcarina > Calcarina defrancii
Isolate number 866
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on July 1998
Location Japan, Ishigaki

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtggtatcccagttattaactgggtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcccatattttaacgcatgcattgcggcgctttgacccctcttaactgagcgttgtgtcttagttagcttagctttcatgcatttgggccttgaaagcaacgaacgtgaccgcaacctcttgttgcctctcataccacatacacaatttattttgtgttgaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattacacaccgcatgcgcgagtctgattaatttattttaatcatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattaggagtaatgatttccattattcgcacacatatatacggcatctttacccggcctgccttgttgcagtgtctttgtgtgtatcgatgtatcttaccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgttcttaccgatggacttctctgtgagtttgagggactggaacccgttctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Calcarina defrancii | genomic DNA | 866 | marine sediment sample | taxon:203400 | Japan:Ishigaki | Jul-1998 | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaaatgctatacacacatagtaacagtgataatttcatatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcacacccacacatacacacacacacaatatgtgatttctctgtatcgcacacattatctttaaggtcttgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtatcaacacacacatcacatacacactactcagcactcaatggtaaactttggttcacacatcgttcgcgattgtaccagtttaaaagtttaactgcaacatgagagacattgagcacgcactgtgtgatatttatatcgcacaattccacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatttanttattgattattacgcgttaacaacaatttacacacacacagnnnnnnnnnnnnacatttattctgtacacacacacacatccttgttaactcgcatcagataaattacatttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgtacttggtgttatgaattaatttcactgtgcatgtatctgaatttcaagtggagggaaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacttattttatgagttcgttttctcgacgctaaccactgattttattacgcacgtaataatttctcaacacacacacacatacgctccagcgatatcgatacacgctcacactccatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactattcagcctgttggaaatacgttacacgcataattatnntctaacggttattaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtctcgcactctgtatcacacacacacatcacacacagagagtgacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttcttttataagattgcaaacactcctcaacctacaaaatgacttggcttgagctcgtatctctgatacgctcgctagactattttcgtacggtctcgatggacgtttcatttattctattttttgcgtgtaagcattgtaattattctttgaaacataagaatttactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactatgtttattgttacccgcagtgtatattttcgaatatttcacttgtcgtgtttgtaactaaacaatttcggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattgatttccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtggtatcccagttattaactgggtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcccatattttaacgcatgcattgcggcgctttgacccctcttaactgagcgttgtgtcttagttagcttagctttcatgcatttgggccttgaaagcaacgaacgtgaccgcaacctcttgttgcctctcataccacatacacaatttattttgtgttgaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattacacaccgcatgcgcgagtctgattaatttattttaatcatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattaggagtaatgatttccattattcgcacacatatatacggcatctttacccggcctgccttgttgcagtgtctttgtgtgtatcgatgtatcttaccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgttcttaccgatggacttctctgtgagtttgagggactggaacccgttctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI