Calcarina gaudichaudii

Order “Rotaliida” > Family “Calcarinidae” > Genus “Calcarina

Original description Orbigny, A. D`., 1826, Ann. Scien. Nat., 7, 245-314
Description Renema, W., Hohenegger, J., 2005, J. For. Res., 35, 15-21

General description

Thick lenticular test with few radial spines. Brownish colour in living individuals caused by diatom symbionts.

Representative pictures

Calcarina gaudichaudii Calcarina gaudichaudii Calcarina gaudichaudii Calcarina gaudichaudii Calcarina gaudichaudii Calcarina gaudichaudii Calcarina gaudichaudii Calcarina gaudichaudii

Specimens

Specimen 336

Species Rotaliida > Calcarinidae > Calcarina > Calcarina gaudichaudii
Isolate number 336
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on December 1996
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

>Calcarina gaudichaudii | genomic DNA | 336 | taxon:203401 | 21 | Japan: Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtgttatcccaattcacactgaattgggtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggccatcattataacgcatgtattgcggcaactttgacccctctgattatttgagcgttgtgtcttagttttttgcttagcatcatgcatttgggccttgaaagcaacgaacgtgaccgcaacctcttgttgcctctcatatacataaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattatacacaccgcatgcgcgagtggcgattatttatttataatcatgcatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctatattcagcacacatatatacggcatctttacccggcctgccttgttgcagtgtctctgtgtgtattgatgttaacttccgtatgtgcaattgtcaattcacggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacacaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatattatttctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI