Calcarina hispida

Order “Rotaliida” > Family “Calcarinidae” > Genus “Calcarina

Original description Brady, H. B., 1876, Proc. Roy. Irish Acad. 2nd series, 2, 1-600
Description Renema, W., Hohenegger, J., 2005, J. For. Res., 35, 15-21

General description

Lenticular trochospirally enrolled test with branching radial spines; test is covered with many little spines.Diatom symbionts result in a brownish colour in living individuals.

Representative pictures

Calcarina hispida, Australia, Lizard Island

Specimens

Specimen 335

Species Rotaliida > Calcarinidae > Calcarina > Calcarina hispida
Isolate number 335
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on December 1996
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccgaacacactgaggattgacaggtattatccagttacagttacactctaactggtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcccatattttaacgcatgttattgcggcgctttgacccctcattaatttgagcgttgtgtcttagtcttttgcttagcaatcatgcatttgggccttgaaagcaacgaacgtgaccgcaacctcttgttgcctctcgtaccaatgtgcaatttctattgtacaaaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttattacacaccgcatgcgcgagtccattttttcggttcgccgcttaaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttattcgcacacatatatacggcatctttacccggcctgccttgttgcagtgtctctgtgtgtattgatgtgattgttattcaatcaattatccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaacccgttctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Calcarina hispida | genomic DNA | 335 | marine sediment sample | taxon:203399 | Japan:Okinawa, Sesoko | Dec-1996 | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttatcttaacccgacagtttaaataagtgttaaaatgctattcacacattaatagtaacaacatagtgataattcatatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcacacccacacatacacacaatatgtgatttctctgtatcgcacttatcttataaggacttgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtatttatcacacacatcactcactactcagcactcaatggtaaactttggttacattcgttcgcgattgtgccagtttaaaagtttaactgcaacatgagagacattgagcacgcactgtgcgatttatcgcgcaattcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcacgtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaattttatttattgtattattacgcgttaacaacaatttacctacacacatagcannnaanncatttattcgtgtcacacacacacacatccttgttaactgatatcaatacgtaaatatttatttatttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgtactggtgttatgaattaatttcactgtgcatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaatcactcagagtttattctctttgcgtttgtatctcgacgctataaccatattattattacgcacgtaataatttccacacacgcaccacgcatcgatacgctacagagaatttattctctcacactttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactattcagcctgttggaaattcacattacacgcacacacaataataatttcacaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactacctaaagcgaaagcagttggctaggctatactctttgtctcactctataatcacacacacatacacacacagagtgacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttttttaataaaatttgcaaatctcctcagccgacaaaatgacttggcttgagctcgtaacttttcttgttacgctcgccacactattttcgtacggtctcgatggacgtttcattttattctatttttgcgtgtaagcattgttattattctttgaaacataagaattttactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactatgtttattgttacccgcagtatattcctttgggaattttacttgtcgtgttctgtaactaaacaatttcggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattgatttccgggggtagtatgctcgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccgaacacactgaggattgacaggtattatccagttacagttacactctaactggtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggcccatattttaacgcatgttattgcggcgctttgacccctcattaatttgagcgttgtgtcttagtcttttgcttagcaatcatgcatttgggccttgaaagcaacgaacgtgaccgcaacctcttgttgcctctcgtaccaatgtgcaatttctattgtacaaaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttattacacaccgcatgcgcgagtccattttttcggttcgccgcttaaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttattcgcacacatatatacggcatctttacccggcctgccttgttgcagtgtctctgtgtgtattgatgtgattgttattcaatcaattatccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaacccgttctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI