Schlumbergerella floresiana

Order “Rotaliida” > Family “Calcarinidae” > Genus “Schlumbergerella

Original description Schlumberger, C., 1896, Mém. Soc. Zool. de France, sér.3, 22, 336-339
Description Hohenegger, J., 2006, Paleobiology, 32, 70-99

General description

Large globular test with projecting spines, coarsely perforated. Brownish colour in living specimen caused by diatom symbionts.

Representative pictures

Schlumbergerella floresiana, Bali Schlumbergerella floresiana, Bali Schlumbergerella floresiana, Bali

Specimens

Specimen 2482

Species Rotaliida > Calcarinidae > Schlumbergerella > Schlumbergerella floresiana
Isolate number 2482
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on February 2001
Location Bali, Indonesia

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccagacacactgaggattgacagattacaatatacagatcttacatgattatgtgataggtggtgcatggccgttcctagttcgtggagtgatctgtctgcttaattgcgtttcactgacggctcatatgattttatggtgtgtcgcgtctcagctgatcaccgcatcaatgagccttgaaagcaacgaacgtgaccgcaacctcttgttattaatttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgtgcatctcatacacacacacctaacctatgttaggtacagcctactttgagagggagttaggcaatcaattagaagtaatgattcccatacacagcacacatatatacggcatctttacccggcccgccttgttgcagtgtctctgtgcgtatttgatgtttaccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatgagggaccgatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Schlumbergerella floresiana | genomic DNA | 2482 | marine sediment sample | taxon:577504 | Indonesia:Bali | Feb-2001 | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttattacataacccgacagtttaaataagtgttacaatgctcactagcttcggacacacacacatcacttatgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggtatgacacacccactatctacggataactcagggaaagtttggctaatacgtacgagacacacatcacttactcagcactcaatggttatagcaggcgagacacattgagcacggcatatctttggctgagcagactttgcgaagtttacttctgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagactgctcttagttctaaggaacgcagcaggcgcgcaaattgcccaatgctagtaccctacagcatagcactatttattcatgtcacacacatatccttgttcactgtgaggcagtgacaagctgtaacggttgagtataatttatgacgagtgtctggcattgccgctccttcgggagcttggcattgttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcatctcagaacctacggataatttatatattgtctgtgtatctgaattttaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggactgaactgcagatacatatcatatctgtaatactcgacacacggcagacctgatactgatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgttttaactgaatgtgcattgaatgtcttatcatgggatgttgcacccgcacatacacacagttacttgatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactacctaaagcgaaagcagttggctaggctatactccttgtgtcattacacacactgacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatatcacatatgcaaatatcctcaacctacaaaatgacttggcttgagctcgtatcatctgtgatacgctcgccataactattttcgtacggtctcgatggacgtttcattttctctcagcgcgtcggcacacatgtttcgcacacttgattttcggagctttgcgctcaataactggtgagatgtaagcacccacactctccttcgggttcgagtgaacatggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattgattttcgggggtagtatgctcgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccagacacactgaggattgacagattacaatatacagatcttacatgattatgtgataggtggtgcatggccgttcctagttcgtggagtgatctgtctgcttaattgcgtttcactgacggctcatatgattttatggtgtgtcgcgtctcagctgatcaccgcatcaatgagccttgaaagcaacgaacgtgaccgcaacctcttgttattaatttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgtgcatctcatacacacacacctaacctatgttaggtacagcctactttgagagggagttaggcaatcaattagaagtaatgattcccatacacagcacacatatatacggcatctttacccggcccgccttgttgcagtgtctctgtgcgtatttgatgtttaccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatgagggaccgatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI