Cycloclypeus carpenteri

Order “Rotaliida” > Family “Nummulitidae” > Genus “Cycloclypeus

Original description Brady, H.B., 1881, Quart. J. Microscop. Scie. (London), 21, 31-71
Further reference Holzmann M., Hohenegger J., Pawlowski J., 2003, J. For. Res., 33, 277-284 (127 KB)
Further reference Holzmann, M., Berney, C., Hohenegger, J., 2006, Symbiosis, 42, 93-101 (3.03 MB)
Description Hohenegger, J., Yordanova, E., Hatta, A., 2000, J. Foram. Res., 30, 3-28
Further reference Hohenegger, J., 2009, Galaxea, Journal of Coral Reef Studies., 2, 81-89

General description

Large discoidal test with annular chambers divided into chamberlets by secondary septa. Brownish colour in living specimens due to diatom endosymbionts.

Representative pictures

Cycloclypeus carpenteri Cycloclypeus carpenteri, gamont, Japan, Sesoko Cycloclypeus carpenteri

Specimens

Specimen 21

Species Rotaliida > Nummulitidae > Cycloclypeus > Cycloclypeus carpenteri
Isolate number 21
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on March 2004
Habitat soft sediment
Depth 80m
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatatcactcttacgtgatatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgacccctcttaattgagcgcgtgtctttgtttgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacacagttctatcatttcgatgtagatgtgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgccttagatgttcgggttgcacacgtgctacaatgattatgcagtgagcatctcattttttacaccaccgcatgcgcgagtctatttatccaccttttgtgtgccttaaaatatgtatcttttgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttaatagcacacatatataacggcgtcttttacccggctttgccttgttgcaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctttatatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaggtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Cycloclypeus carpenteri | genomic DNA | 21 | sediment sample | taxon:196926 | single cell | Japan:Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacccatacacactcatacacgcattacacgaggttgtttacgggagtaacaatttcagcgtgaatcacaccatacagtgaatcactgaaatatattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctcatatgatacgtatacactgtatcgtatcatatatatatacacacacatacattgatttctctgtatcgcttgtcttataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctcattcacatacacatacatacacatacacactcaatgcatatgtaagacactactcagcactcaatggtaaactttggcttcgttcgcgtcgccagtttaaagtttaattgcaacatgagagacattgagcacgcacgtgtcgtaccttcaggtgcttcacattacgctgagcggacttttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcacacatacgattgatattattacgcgttaacaatttactgacaacacacatacagtgtgcagcatatatataacacaattatatttattctgtcacccgacagaacatacacacatccttgttcacgtaaatatcctcgctatatgtaatttattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttctggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaccggtgtttgtaatatttcactgttcatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacacaatatacgaatgaattctattcattctgcgtttgatagtttttacgcgttactttatatgtctcgcgtatcgacgctacctaaatgaaattattaccacgtatacggtttaccgtgttacagtgatatttcttatacatgcacactctctcctgtatcatcacacacatacacacccactgcagcaactgagtgattatatcattatatcatacgtcatcgtacgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcagcctgttaagaattattacgtacatacgctgcgcttaacacacacatacacaccccgctgcagcagctgggtaaagcttatattatacgctatgtatataattcatataacggtataaatggccatggggatagttggaggtcacagtgctgctgggcgagaggtgaaattcattgaccctagcaaggacttccaaaagcgaaagccagttggctaaggctaaactcttgggcttgtggcacgtgataaataccgtaaagtctcgctgtttcacacacacacacatacatacctctgcagcagagatatattttatacgtatcaacgtagcacattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatctcctcagcctacaaaatgacttggcttgagctcgtaactctgttacgctcgcctgactattttcgtacggtctcgatggacgtttcatttaactatctttgcgtgtaagcattgtactaatctttgaaatacaagattgtactgcgtgcacttattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatgtctttgggcatttcatctgtcgtgttgtaattaacaccttttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatattgctctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatatcactcttacgtgatatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgacccctcttaattgagcgcgtgtctttgtttgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacacagttctatcatttcgatgtagatgtgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgccttagatgttcgggttgcacacgtgctacaatgattatgcagtgagcatctcattttttacaccaccgcatgcgcgagtctatttatccaccttttgtgtgccttaaaatatgtatcttttgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttaatagcacacatatataacggcgtcttttacccggctttgccttgttgcaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctttatatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaggtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 659

Species Rotaliida > Nummulitidae > Cycloclypeus > Cycloclypeus carpenteri
Isolate number 659
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on November 1997
Habitat soft sediment
Location Japan, Minna Jima

Barcode sequence

SSU partial

>Cycloclypeus carpenteri | genomic DNA | 659 | taxon:196926 | 1 | Japan:Minna Jima | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatatcactcttacgtgatatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgacccctcttaattgagcgcgtgtctttgtttgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacacagttctatcatttcgatgtagatgtgtgcaaaaaggcccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcaccttttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttatagcacacatatatacggcgtctttacccggcttgccttgttgcaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctttatatatgcacacctatggccacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

LSU partial

>Cycloclypeus carpenteri | genomic DNA | 659 | taxon:196926 | 14 | Japan:Minna Jima | 28S rRNA | 28S rRNA | 28S ribosomal RNA gcgcaataatagaaactaaccaggattcccttagtaacggcgagtgaagtgggaagcaatgcatacgtcgcgtaatttattacgtgttcgtagcttagcccgtcgatataatccattcttagctgtcgtacttcggtacatccgctggaaggaattgtagcatcgaaagcattcaagttgtattcatactgcaagcataataatacacacatacacaccccgctgcaagtactatcgtaatacatacagtgtatcatatatacgattcaaacacacagcgtttagcgctggaaagcaatcattgtagttttactacagccatagagtgtgacagccacgttttatgaaatttgatatactctctcgtaagtacacacacgcagtcttatattatatatgctccatgcagtgatatatatacgcatcacgcgtcgaatacgtaattcgtgaatgttgaccctgagtcgagttgttt

See sequence on NCBI