Nummulites venosus

Order “Rotaliida” > Family “Nummulitidae” > Genus “Nummulites

Original description Fichtel, L., Moll, J., P., C., 1798, Vienna, Camesina
Further reference Holzmann M., Hohenegger J., Pawlowski J., 2003, J. For. Res., 33, 277-284 (127 KB)
Further reference Holzmann, M., Berney, C., Hohenegger, J., 2006, Symbiosis, 42, 93-101 (3.03 MB)
Description Hohenegger, J., Yordanova, E., Hatta, A., 2000, J. Foram. Res., 30, 3-28
Description Hottinger, L., 1977, Mémoires du Muséum National d`Histoire Naturelle, Paris., 40, Série C, 1-159

General description

Involute test, planispirally enrolled with undivided chambers. Living specimens are brownish due to diatom endosymbionts

Representative pictures

Nummulites venosus Nummulites venosus

Specimens

Specimen 11

Species Rotaliida > Nummulitidae > Nummulites > Nummulites venosus
Isolate number 11
Collector Johann Hohenegger
Collected on March 2004
Habitat soft sediment
Depth 65m
Description Schizont
Location Japan, Motobu, Okinawa

Barcode sequence

SSU partial

>Nummulites venosus | genomic DNA | 11 | sediment sample | taxon:159862 | single cell, Schizont | Japan:Motobu, Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtataacactatttatatgtgttatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgacccctcttaattgagcgcgtgtctttgattgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttacctttataccaaacacgttgcagtaataattcttattatctcgcttcgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgccgagtctatttattcaccattttgtgtgttttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcctgccttgttgcaggtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctctatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 301

Species Rotaliida > Nummulitidae > Nummulites > Nummulites venosus
Isolate number 301
Collector Johann Hohenegger
Collected on October 1996
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtataacactwtttaygtgttatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgacccctcttaattgagcgcgtgtctttgattgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttacctttataaccaaacacgtgcagtaataattcttattatctcgcttcgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcaccatcttgtgtgttttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcctgccttgttgcaggtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctctatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequences

SSU total

>Nummulites venosus | genomic DNA | 301 | taxon:159862 | single cell | Japan:Sesoko Okinawa | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacccatacacactcatacacgcattatacgaggttgattacgggagtaacaatttcagcgtgaatcacacccacagtgaatcactgaaatatacacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctcatatgattacgcatactctgtatcgtatcatatattatacacacatacattgatttctctgtatcgcttgtcttataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctcattcacacacatacacatacattcaatgtatatgtaagacactactcagcactcaatggtaaactttggcttcgttcgcgtcgccagtttgaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtgcttcacatttacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcacatacgattgatattattacgcgttaacaatttactaacacacacatataaattatatagtgtgcagcatatataacacaattatatttattctgtcacccgacagaacacacacatccttgttcacgtaaatatcctcgctatatgtaattaattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgtttgtaatatttcactgttcacgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacacaatatatgaatgaattctattcattctgcgtttgatagtttctacgcgtcactatatattatatagtctcgcgtatcgacgctacctaaatgaaattattaccacgtatacggtttaccgtgttacagtgatatttctacaacatgcacactcgctcgctgtatcataccacacatacacaatctctgcagcagctgagtgatacaatataccatacgtcatcgtatgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcagcctgttaagaattattacgtacatatgctgcggttaacacacatacacacccgctgcagcagctggtaagcttattattatacgctatgtataaattcataacggttataaatgtcgatggggatagttggagtcaacagtwctgctggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgcttgcgcgcgtgatataataactctcgctgtctatacacacatacacactctgcggcagagataatacattatatatgcagcgcattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatctcctcagcctacaaaatgacttggcttgagctcgtaactctgttacgctcgcctgactattttcgtacggtctcgatggacgtttcatttaactatctttgcgtgtaagcattgtactaatctttgaaacacaagattgtactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatgtcttcgggcatttcatctgtcgcgttgtaattaacaccatttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatattgttctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtataacactwtttaygtgttatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgacccctcttaattgagcgcgtgtctttgattgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttacctttataaccaaacacgtgcagtaataattcttattatctcgcttcgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcaccatcttgtgtgttttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcctgccttgttgcaggtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctctatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

LSU partial

>Nummulites venosus | genomic DNA | 301 | taxon:159862 | 1 | Japan:Minnu, Okinawa | 28S rRNA | 28S rRNA | 28S ribosomal RNA gcgcaataatagaaactaaccaggattcccttagtaacggcgagtgaagtgggaagcaatgcatacgtcgcgtaatttattacgtgttcgtagctcagcccgtcgatataatccattcttagctgtcgtacttcggtacctctgctggaaggaattgtagcatcgaaagcattcaagttgtattcatacactacgcagtcatattatacacacacatacacaccccgctgcaagtgctataataatacatacagtgtatcatatatacgattcaaacacacagcgtttagcgctggaaagcaatcattgtagttttactacagccatagagtgtgacagccacgttttatggaatttgatatactatatcgcacacacgcagtcttattgtatatgtcacgcggtagaatacgtaattcgtgaatgttgaccctgagtcgagttgttt

See sequence on NCBI

Specimen 9

Species Rotaliida > Nummulitidae > Nummulites > Nummulites venosus
Isolate number 9
Collector Johann Hohenegger
Collected on March 2004
Habitat soft sediment
Depth 19m
Description Agamont
Location Japan, Motobu, Okinawa

Barcode sequence

SSU partial

>Nummulites venosus | genomic DNA | 9 | sediment sample | taxon:159862 | single cell, Agamont | Japan:Motobu, Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgcatatcactatttatgcgatatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgacccctcttaattgagcgcgtgtctttgattgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttacctttataccaaacacggtgcactaatattctaattattactcgcttcgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattggcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcaccattttgtgtgttttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcctgccttgttgcaggtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctctatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI