Operculina discoidalis

Order “Rotaliida” > Family “Nummulitidae” > Genus “Operculina

Original description Orbigny, A. D’, 1826, Annales du Museum d’Histoire Naturelles, Paris, 7, 1-275
Description Hohenegger, J., Yordanova, E., Hatta, A., 2000, J. Foram. Res., 30, 3-28
Further reference Holzmann, M., Berney, C., Hohenegger, J., 2006, Symbiosis, 42, 93-101 (3.03 MB)

General description

Involute test with prominent surface ornamentation and undivided chambers. Brownish colour in living specimens caused by diatom symbionts.

Representative pictures

Operculina discoidalis

Specimens

Specimen 253

Species Rotaliida > Nummulitidae > Operculina > Operculina discoidalis
Isolate number 253
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on August 1996
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatcatgctatacgtatgatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtctgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacaatagcttctatattttatatagacttttgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcaccttttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggctaccttgttgtaagtttcttgtgcgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatatttatatattgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Operculina discoidalis | genomic DNA | 253 | sediment sample | taxon:311571 | single cell | Japan:Sesoko, Okinawa | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacccatacacactcatacacgcattacacgaggttgtttacgggagtaacaatttcagcgtgaatcacaccatatagtgaatcactgaaatgtattacattacagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctcatatatgcatggtacatgtatcatgtaatatatactgtacacacaaatacattgatttctctgtatcgcgcttatcttaataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctcatatcatttacatacacatacacctatcaatgtatttatatgtaagacacacacactactcagcactcaatggtaaactttggcttcgttcgcgtcgccagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgcgccttcgggtgcttcacatctacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcacatacacgattgatattattacgcgttaacaatttactgacaacacacatacagtgtgcagcatatataacacaattatatttactctgtcacccgacagtgtacatacacacacacatccttgttcacgtaaatatcctcgctatatgtaattaattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaccggtgtttgtaatatttcactgttcatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggntaagaggctcgtagttggattgaactgcaaacacaatatatgaatgaattctaattcattctgcgtttgatagttttttacgcgctacctttatacggtcgcggtatcgacgctaccaaaaatgaaattattaccacgtatacggtttaccgtgctacagtaatatttcttatacatgcacactcgctcgctgtatcacacacatacatgacccactgcagcaactgagtgatcaatatacgatacgtcatcgtatgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcagcctgttaagaattattacgtgcatcgcacacacatacatacacacccgctgcacacagcgctagtaagcttatattacgctatgtatataattcataacggttataaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgcttgcgcaggtgaatatatcttcgatcgcagtcacacacatacacacacttctgcagcagagatataatatgttacctacagcgcattacactttacaatgaagancgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatctmctcagcctacaaaatgacttggcttgagctagcaactctgttgcgctcgcctgactattttcgtacggtctcgatggacgtttcatttaactatctttgcgtgtaagcattgtactaatctttgtaacataagattgtactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatgtctttgggcatttcatctgtcgtgttgtaattaaacaccttttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatcttcatctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatcatgctatacgtatgatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtctgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacaatagcttctatattttatatagacttttgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcaccttttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggctaccttgttgtaagtttcttgtgcgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatatttatatattgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 8

Species Rotaliida > Nummulitidae > Operculina > Operculina discoidalis
Isolate number 8
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on March 2004
Depth 19m
Location Japan, Motobu, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatcatagctatatgcttatgatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtctgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacaatagtcctatatttttatatagactttgtgcaaaaaggccttttaaactagagggaccgctgttacttttcttaaaccagaggaaggttgcggcaataacagggtctgtgatgcccttagatgttccgggcttgcacacgtgctacaatgatttattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcaccttttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgcgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatattttatatattgcacacctatggaaacttaaacgaacagtgtggtctagaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Operculina discoidalis | genomic DNA | 8 | sediment sample | taxon:311571 | Single cell | Japan:Motobu, Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacccatacacactcatacacgcattatatacgaggttgtttacgggagtaacaatttcagcgtgaatcacatcctacagtgaatcactgaaatgtactacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctcatatattcatggtacctgtatcatgtatatatatactgtacacacatacaaatacattgatttctctgtatcgcgcttatcttaataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctcatattcatttacatacacatacacctacacaatgtattatatgtaagacaccactactcagcactcaatggtaaactttggcttcgttcgcgccgccggtttaaaggttaactgcacatgagagacattgagcacgcacgtgtcgcgccttcgggtgcttcacatctacgctgagcagacttgcgaagttactttgcgaagcatgcatacaagcatctacagcatcaagtcccaggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaaggagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctttttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcacatacacgattgatattattacgcgttaacaatttactgacaacacacataatacagtgtgcagcatatatataacacaattatatttactctgtcacccgacagtgtattcatacacacacatccttgttcacgtaaatatcctcgctatatgtaattaattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaccggtgtttgtaatatttcactgttcatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacacaatatatgagtgaattctattcattctgcgtttgatagtttttatacgcgctacctttatacggttcgcgtatcgacgctacctacaatgaaattattacctacgtatacggtttaccgtgctacagtaatatttcttataacacgcacactcgctcgctgtatcacacatatacatgacccactgcagcaactgagtgatcaatctacgatacgtcatcgtatgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcatagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcacgggatgttgcactttcagcctgttaagaattattacgtgcatcacacacatacacaccttgtgcacacagcgctaagtaagcttatattacgctatggatataattcataaacggttataaatgttgatggggatagtggagtcacacagtactgctggcgagaggtgaaattcattgaccctagcaagacttaccaaaagcgaaagcagtggctaggctatactctttgtgcttgcgcaggtgattacatattttcttatcgcagtcactcacacacatacatacacacactgctgcagcagaaatatatgacaccacagcgcattacactttcaatgaagaacgaaggttggggggtcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatctcctcagcctacaaaatgacttggcttgagctagcaactctgttgcgctcgcctgactattttcgtacggtctcgaatggacgtttcatttaactatctttgcgtgtaagcattgtactaatctttgaaccataagattgtactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatatctttggatatttcatctgtcgtgttgtaattaacactttttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatcttcatctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatcatagctatatgcttatgatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtctgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacaatagtcctatatttttatatagactttgtgcaaaaaggccttttaaactagagggaccgctgttacttttcttaaaccagaggaaggttgcggcaataacagggtctgtgatgcccttagatgttccgggcttgcacacgtgctacaatgatttattgcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcaccttttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgcgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatattttatatattgcacacctatggaaacttaaacgaacagtgtggtctagaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI