Planoperculina heterosteginoides

Order “Rotaliida” > Family “Nummulitidae” > Genus “Planoperculina

Original description Hofker, J., 1933, Dansk Naturh. Foren. Kobenhavn, Vidensk. Meddel., Kobenhavn, Danmark., 148
Further reference Holzmann, M., Berney, C., Hohenegger, J., 2006, Symbiosis, 42, 93-101 (3.03 MB)
Description Hohenegger, J., Yordanova, E., Hatta, A., 2000, J. Foram. Res., 30, 3-28

General description

Flat and fragile test, chambers are incompletely divided by secondary septa into chamberlets. Surface ornamentation in form of knobs around the center of the test. Brownish colour in living specimens due to diatom symbionts.

Representative pictures

Planoperculina heterosteginoides Planoperculina heterosteginoides; Japan, Sesoko Planoperculina heterosteginoides; Japan, Sesoko Planoperculina heterosteginoides; Japan, Sesoko

Specimens

Specimen 17

Species Rotaliida > Nummulitidae > Planoperculina > Planoperculina heterosteginoides
Isolate number 17
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on March 2004
Habitat soft sediment
Depth 80m
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatattcactcactctctgtagtagtgatatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtctgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacgttgcagtaatattttcattaccttgcttcgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgccgagtctatttattcaccatttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctcttatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Planoperculina heterosteginoides | genomic DNA | 17 | sediment sample | taxon:311573 | single cell | Japan:Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacccatacacactcatacacgcattacacgaggttgtttacgggagtaacaatttcagcgtgaatcacaccctatagtgaatcactgaaatatacacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcttatatgatacgcatacccagtatcgtatcatacatacactgtatacacatacattgatttctctgtatcgcttgcttataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctatctcattccacacacatacccctacattcatgggtatgtgaaagactactcagcactcatagggtaaactttggcttcgttcgcgtcgcccgtttaaagttaactgcacctgagagacattgagcacgcacgtgtcgaacctttgggtgcttcacatcttcgctgaaacagactttgcgaagtttactttgcgaagcatgcagcatacaagcatctacagcatcaagtccaggttggcaagtgtattttgacctttcaagagcagtcacgcatagggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttttaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcacatacacgattgatattattacgcgttaacaatttactgacaacacacccactctatatattagatgggcgtgtgcagcatatataacacaattatttattctgtcacccgacagaacatacacacacatccttgttcacgtaaatatcctcgctatatgtaattaattttactgaggcagtgacaagctgtaatggttgagtataaaaatgacgagtgtctggcattgccgctccttctggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaccggtgtttgtaatatttcactgttcatgaatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacacaatatatgaatgaattctattcattctgcgtttgatagtttttacgcgttacttttacgtctcgcgtatcgacgctacctacatgaaattattaccacgtatacggtttaccgtgttacagtgatatttcttatacatcatgcacagacgctcacagtagtgcttacacacacacacacatacacaagctgtagcgactgagtcatcgtatgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcagcatgttaagaattattacgtacatacgctgcgcttaacacacatacacacccgtagcagcgctagtaagcctaagcttatacgctatgtataattcataacggttttaaatgtcgatggggatagttggagtcacagtactgctgggcgagaggtgaaattcattgaccctagcaagacttaccaaaagcgaaagcagttggctaggctatactctttgtgcttgcgcacgtgaccactgtgatacgtatgtctcacgctgtcagtcattacacacacatacacacttctgcagcagagacatacacacgtatccaacgtagcgcattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatctcctcagcctacaaaatgacttggcttgagctcgtaactctgttacgctcgcctgactattttcgtacggtctcgatggacgtttcatttaactatctttgcgtgtaagcattgtactaatctttgaaacacaagattgtactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatgtctttggacatttcatctgtcgttgttgtaattaacaccttttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatatttcactccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatattcactcactctctgtagtagtgatatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtctgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacgttgcagtaatattttcattaccttgcttcgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgccgagtctatttattcaccatttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctcttatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI