Planostegina longisepta

Order “Rotaliida” > Family “Nummulitidae” > Genus “Planostegina

Original description Zheng, S., Y., 1979, Stud. Mar. Sin., 15, 1-27
Further reference Holzmann, M., Berney, C., Hohenegger, J., 2006, Symbiosis, 42, 93-101 (3.03 MB)
Description Hohenegger, J., 2004, J. For. Res., 34, 9-33

General description

Very flat and evolute test with granular surface ornamentation. Chambers are divided into chamberlets by secondary septa. Diatom symbionts cause brownish colour in living specimens.

Representative pictures

Planostegina longisepta Planostegina longisepta, Japan, Sesoko Planostegina longisepta, Japan, Sesoko

Specimens

Specimen 42

Species Rotaliida > Nummulitidae > Planostegina > Planostegina longisepta
Isolate number 42
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on March 2004
Habitat soft sediment
Depth 79m
Location Japan, Amami-O-Shima

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatattcacttacatattcttaataatatgtctagtggtatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgactttgtctgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaaccaccgttgcacgtaaatatttttcattacctttgcttccgtgcaaaaaggccttttaaactagagggaccgctggttactttcttaaaccagaggaaggttgccggcaataacaggttctgtgatgcccttagatgttccgggctgcacacgtgctacaaatgattattgcagtgagcatctcatttaatcacaccgcatgcgcgagtctatttattcaccatttgtgtgctttaaatatgtatcttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatacctcttgtatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Planostegina longisepta | genomic DNA | 42 | sediment sample | taxon:311574 | single cell | Japan:Amami-O-Shima | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacccatacacactcatacacgcattacacgaggttgtttacgggagtaacaatttcagcgtgaatcacaccatatagtgaatcactgaaatatacacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctcttatgatacgcatacactgtatcgtatcatacatacactgtacacacatacattgatttctctgtatcgcttgtcttataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctatctcattcacacacacacacatacacatacactcatcaatgtatatgtgagacactactcagcactcaatggtaaactttggcttcgttcgcgtcgccagtttaaagtttaactgcacatgagagacatttgagcacgcacgtgtcgtaacttcgggtgcttcacatctacgctgagcagacttttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacaagggttggcaagtgtatttttgaaccttcaaagaagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcacatacacgattgatattattacgcgttaacaatttactgacaacacacccagtctaactattagatagaggtgtgcagcatatataacacaatttattctgtcacccgacagaacatacacacacacacatccttgttcacgtaaatatcctcgctatatgtaattaattttactgaggcagtgacaagctgtaatggttgagtataaaaatgacgagtgtctggcattgccgctccttctggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaccggtgtttgtaatatttcactgttcatgaatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacacaatatacgaatgaattctattcattctgcgtttgatagtttttacgcgttactttacgtctcgcgtattcgacgctacctaaatgaaattattaccacgtatacggtttaccgtgttacagtgatatttcttacacatgtcacgcacagacgcttacagtacacacatacacagactgtagcgactgagtgattaactatatcatacgtcatcgtacgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatatgcattgaatgtcttatcatgggatgttgcactttcagcttgttaagaattattacgtacattacgctgcgcttcatacacatacacacccgctgcagctctcgtaagcttatacgctatgtatgattcataacggtttaaaatggccgatgggggataagttggagtccaccagtactgctggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatacttctttgggcttgcgcaccgtgaccccctgagatacgtaaagtctcacgctgtcatacacacacacacacacacttttgcagcaggagatatataacccacgtatcaacgtagcgcattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatctcctcagcctacaaaatgacttggcttgagctcgtaaccctgttacgctcgcctgactattttcgtacggtctcgatggacgtttcatttaactatctttgcgtgtaagcattgtactaatctttgaaacacaagattgtactgcgtgcttacttgattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatgtctttggacatttcatctgtcgttgttgtaattaacaccttttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatcttgctttccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatattcacttacatattcttaataatatgtctagtggtatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgactttgtctgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaaccaccgttgcacgtaaatatttttcattacctttgcttccgtgcaaaaaggccttttaaactagagggaccgctggttactttcttaaaccagaggaaggttgccggcaataacaggttctgtgatgcccttagatgttccgggctgcacacgtgctacaaatgattattgcagtgagcatctcatttaatcacaccgcatgcgcgagtctatttattcaccatttgtgtgctttaaatatgtatcttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatacctcttgtatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI