Planostegina operculinoides

Order “Rotaliida” > Family “Nummulitidae” > Genus “Planostegina

Original description Hofker, J., 1927, In: Siboga Expeditie; Uitkomsten op zoologisch, botanisch, oceanographisch en geologisch gebied,versameld in Nedelandsch Oost-Indi 1899-1900 aan boord H.M. Siboga. Leiden, E. J. Brill, Monografen 4, 1-78
Further reference Holzmann M., Hohenegger J., Pawlowski J., 2003, J. For. Res., 33, 277-284 (127 KB)
Further reference Holzmann, M., Berney, C., Hohenegger, J., 2006, Symbiosis, 42, 93-101 (3.03 MB)
Description Hohenegger, J., Yordanova, E., Hatta, A., 2000, J. Foram. Res., 30, 3-28

General description

Flat and thin test, chambers are divided by secondary septa into chamberlets. In P. operculinoides surface ornamentation is present in the form of knobs around the center of the test , it is less pronounced than in P. longisepta. Brownish colour in living specimens due to diatom symbionts.

Representative pictures

Planostegina operculinoides Planostegina operculinoides, Japan, Minna Jima Planostegina operculinoides, Japan, Minna Jima

Specimens

Specimen 16

Species Rotaliida > Nummulitidae > Planostegina > Planostegina operculinoides
Isolate number 16
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on March 2004
Habitat soft sediment
Depth 80m
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatattcacttacatattcttaataatatgtctagtggtatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtctgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacgttgcagtaatatttttcattactttgcttcgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtggatgcccttagatgttccgggctgcacacgtgctacatgattattgcagtgagcatctcatttatacacaccgcatgcgcgagtcttatttattcacccatttgtgtgctttaaatatgtatcttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatacctcttgtatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Other sequence

SSU total

>Planostegina operculinoides | genomic DNA | 16 | taxon:196931 | 14 | Japan | Jun-2003 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacccatacacactcatacacgcattacacgaggttgattacgggagtaacaatttcagcgtgaatcacaccatatagtgaatcactgaaatatacacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctcatatgatacgcatacactgtatcgtatcatacatacactgtacacacatacattgatttctctgtatcgcttgtcttataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctatctcattcacacacacacatacacatacatcaatgtatatgtaagacactactcagcactcaatgggtaaactttgggcttcgttcgcgtcgccagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtaccttcgggtgcttcacatctacgccgagcagacttttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaaaagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcaacaggcgcgtaaattgcccaatgctagtaccctacaatcacatacacgattgatattattacgcgttaacaatttactgacaacacacccactctaactattagataggggtgtgcagcatatataacacaattatatttattctgtcacccgacagaacatacacacacacaatccttgttcacgtaaatatcctcgctatatgtaattaattttactgaggcagtgacaagctgtaatggttgagtataaaaatgacgagtgtctggcattgccgctccttctggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaccggtgtttgtaatatttcactgttcatgaatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacacaatatacgaatgaattctattcattctgcgtttgatagtttttacgcattactttacgtctcgcgtattcgacgctacctaaatgaaattattaccacgtatacggtttaccgtgttacagtgatatttcttatacatgtcacgcacagacgcttacagtagtgcttacacacacacacacatacacagactgtagcgactgagtgatttactataacatacgtcatcgtacgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcagcttgttaagaattattacgtacattacgctgcgccttcatacacatacacacccgctgcagctctcgtaaagcttatacgctatgtatgattcataacggtttaaaaatgtcgatgggggatagttggagtcacagtactgctgggcgagaggtggaattcattgaccctagcaaggactaccaaaagcgaaagcaattggctaaggctatactcctttggcttggcgcacgtggaccacctgagaatacgtaagtctcacgctggcaggtcatatcacacacacacacacacacacacttctgcagcagagatacatacaatcacgtatcaacgtagcgcattacactttacaatgaagaacgaaggttgggggatcaaagaggatcagatacccttgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatttcctcagcctacaaaatgacttggcttgagctcgtaaccctgttacgctcgcctgactattttcgtacggtctcgatggacgtttcatttaactatctttgcgtgtaagcattgtactaatctttgaaacacaagattgtactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatgtctttggacatttcatctgtcgttgtggtaattaacaccttttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatcttgctttccaggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatattcacttacatattcttaataatatgtctagtggtatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtctgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacgttgcagtaatatttttcattactttgcttcgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtggatgcccttagatgttccgggctgcacacgtgctacatgattattgcagtgagcatctcatttatacacaccgcatgcgcgagtcttatttattcacccatttgtgtgctttaaatatgtatcttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatacctcttgtatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 662

Species Rotaliida > Nummulitidae > Planostegina > Planostegina operculinoides
Isolate number 662
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on November 1997
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

>Planostegina operculinoides | genomic DNA | 662 | taxon:196931 | 1 | Japan:Minnu | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtatattcacttacatattcttaataatatgtctagtggtatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcgctttgacccctcttaattgagcgcgtgtctttgtctgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacgttgcagtaatatttttcattaccttgcttcgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttatacacaccgcatgcgcgagtctatttattcaccatttgtgtgctttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatacctcttgtatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

LSU partial

>Planostegina operculinoides | genomic DNA | 662 | taxon:196931 | 18 | Japan:Minnu, Okinawa | 28S rRNA | 28S rRNA | 28S ribosomal RNA gcgcaataatagaaactaaccaggattcccttagtaacggcgagtgaagtgggaagcaatgcatacgtcgcgtaatttattacgtgttcgtagctcagcccgtcgatataatccattcttagctgtcgtacttcggtacctctgctggaaggaattgtagcatcgaaagcattcaagttgtattcatacacataccacgcatgcatataatacacacacacacatacacaccccgctgcaagtgctattacatatagtgtatcatatatacgattcaaacacacagcgtttagcgctggaaagcaatcattgtagttttactacagccatagagtgtgacagccacgttttatggaatttgatatactctcgtaacacacacacgcgcagtcttatgtatatatatatgcccctgcagtgaatacgtaattcgtgaatgttgaccctgagtcgagttgttt

See sequence on NCBI