Ammonia aomoriensis T6

Order “Rotaliida” > Family “Rotaliidae” > Genus “Ammonia

Original description Asano, K., 1951, Hosokawa Printing, Tokyo, 1-21
Revision Hayward, B., W., Holzmann, M., Grenfell, H., R., Pawlowski, J., 2004, Mar. Micropal., 50, 237-271 (1.58 MB)
Further reference Schweizer, M., Polovodova, I., Nikulina, A., Schönfeld, J., 2011, Helgol. Mar. Res., 65, 1-10 (588 KB)

General description

See the paper of Hayward et al., 2004 for a morphological characterization.

Representative pictures

Ammonia aomoriensis T6_132, umbilical view Ammonia aomoriensis T6_132, spiral view

Specimens

Specimen 132

Ammonia aomoriensis T6_132, spiral view Ammonia aomoriensis T6_132, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia aomoriensis T6
Isolate number 132
Collector Bruce Hayward
Identifier Maria Holzmann
Collected on June 2000
Habitat salt marsh
Location China, Yalu Jiang

Barcode sequences

SSU partial
SSU partial

Other sequence

LSU partial

>Ammonia sp. 132 | genomic DNA | 132 | taxon:155816 | 8 | single cell | true | China:Yalu Jiang | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataacagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaatatatttatgcgtctctggcgcatatttttagcccgtcgatactatcctagcgtattaccggtttcggccggtagcccaatacgcgggaattgtagcatcgtaataaaatatacaccatgcctgcgtcgcaaacgtatatacacgtatactcacacacacatactcgtacgcgtacacaccccttgcaaacacacagcgctcccgcgttggaaagcaagtctatatcctctttggatatgccatagagtgtgacagccacgtttgaaacaccctacgtaccgtacacacacacatacgtaaaaatacgcgctgcttcgcatacgcataccgtatataacctgagtcgagttattt

See sequence on NCBI