Uvigerina phlegeri

Representative pictures

Uvigerina phlegeri_U239

Specimens

Specimen U239

Uvigerina phlegeri_U239
Species Rotaliida > Uvigerinidae > Uvigerina > Uvigerina phlegeri
Isolate number U239
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on October 2003
Habitat soft sediment
Depth 321m
Location Portugal, Nazaré Canyon
Latitude, Longitude 39.388, -9.15

Barcode sequences

SSU partial

>Uvigerina phlegeri | genomic DNA | U239-2 | taxon:503359 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatatactttctctctcgcactctcacgagtgtgtgtgctgtaaagtcatatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcctaattgcgtttcactaagggcctatacaattacgtatgttgttattgcactttgacccctccttcgcgggtgcgtgtgtctttgactgcttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtatacccttataacacagttatatttttattttatgctttaccgcatatatactaatttgctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattatacaccgcatgcgcgagtccatttattcattttaccttcgggttatgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgcgtatagttgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcattgcgtatatcttatgcgctctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Uvigerina phlegeri | genomic DNA | U239-5b | taxon:503359 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatatactttctcgcactctcgagtgtgctgtaaagtcatatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttattgcactttgacccctccttcgcgggtgcgtgtgtctttgactgcttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtatacccttataacacagttatatttttattttatgctttaccgcatatatactaatttgctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttattatacaccgcatgcgcgagtccatttattcattttaccttcgggttatgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgcgtatagttgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcattgcgcgtatatttcatatgcgctctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaagctgcagaaggatca

See sequence on NCBI