Elphidium aculeatum

Order “Rotaliida” > Family “Elphidiidae” > Genus “Elphidium

Original description Orbigny, A. D`., 1846, Paris: Gide et Comp.
Further reference Pillet L, de Vargas C, Pawlowski J, 2011-07-01, Protist, 162, 3, 394-404

General description

Test strongly compressed; periphery acute, with a strong narrow keel bearing irregular short spines at the end of most sutures.

Representative pictures

Specimens

Specimen A53

E. aculeatum A53 E. aculeatum A53 E. aculeatum A53 E. aculeatum A53
Species Rotaliida > Elphidiidae > Elphidium > Elphidium aculeatum
Isolate number A53
Collector Loic Pillet
Identifier Loic Pillet
Collected on August 2007
Habitat Macro algae
Depth 0
Location English Channel, Trebeurden, France
Latitude, Longitude 48.7878, -3.5823

Barcode sequences

SSU partial

aagggcaccacaagaacgcgcggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaacttacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattacttcattaagtatctaatctttatgtatcgtacctctgtgtatgttcaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatatttttatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatgcgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaacttacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttatgtatcgtacctctgtgtatgttcaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatatttttatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Other sequences

SSU total

>Elphidium aculeatum | genomic DNA | A53.1 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcawgtggttattttttaataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggtttaactaatttacgaacaacggataactcagggaaagtttggctaatacgtacgaacaattattattgcatacagttacgcatgaatgagattgtatacgtgcgcgtgcttgcaccgcacacggcagatattgtgtatttataacacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatatatctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgtttttatacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatatttttattatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtactatatacattattatacaatacacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgcagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgcggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaacttacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattacttcattaagtatctaatctttatgtatcgtacctctgtgtatgttcaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatatttttatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatgcgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU total

>Elphidium aculeatum | genomic DNA | A53.2 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA tattttttaataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggtttaactaatttacgaacaacggataactcagggaaagtttggctaatacgtacgaacaattattattgcatacagttacgcatgaatgagattgtatacgtgcgcgtgcttgcgccgcacacggcagatattgtgtatttataacacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatatatctattgaggcagtgataagctgtaacggttgagtattaatctaatttggcgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgtttttatacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatattttatatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtactatatacattattatacaatacacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgtagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaacttacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttatgtatcgtacctctgtgtatgttcaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatatttttatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Specimen D18

E. aculeatum D18 E. aculeatum D18
Species Rotaliida > Elphidiidae > Elphidium > Elphidium aculeatum
Isolate number D18
Collector Jan Pawlowski
Identifier Loic Pillet
Collected on September 2008
Location Mediterranean Sea, Porquerolles, France
Latitude, Longitude 43.0012, 6.20422

Barcode sequences

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatccgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatccgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaacttacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Other sequences

SSU total

>Elphidium aculeatum | genomic DNA | D18.2 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgmagtggttatttaacccgacagtttaactaagtgttattaacgtcaatagattactaatctatacaacccacgtaacagtgaatgcacatttcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctattgctatattcacgcttaatgcgcgaatcggcactacacaacacatacttgcttacgataataattatattattatcgggtaatacgtgatttcttcactgagaagctattgcattactgcagtacgcttatcataccattacaacacatcttatggataactcagggaaagtttggctaatacgtacgagtcacattacttcacacagcaattgttattcgcaatctgtcgcgtctaccgcattcatgaaacaaacattaattataaatgcgcgcgcgcactcatctgcgaaataactaaactaattactcagcactcaatggtaaacttatgcgtctgcgtacttctgtcttcggacgatgcgcttacgcatgattcgtttaactgcaacatgagagacattgagcacgcagtctttcgatccttcgtgattgattgacatctacgctgagcagactttaagattcttaatcttgaagcatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatatcatctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatatggcgtgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgttatcatatacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatatttttatatatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctttcaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtataccatcattatacaatacacatacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgtagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatccgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU total

>Elphidium aculeatum | genomic DNA | D18.1 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA tatttaacccgacagtttaactaagtgttattaacatcaatagattactaatctatacaacccacgtaacagtgaatgcacatttcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctattgctatattcacgcttaatgcgcgaatcggcactacacaacacatacttgcttacgataataattatattattatcgggtaatacgtgatttcttcactgagaagctattgcattactgcagtacgcttatcacaccattacaacacatcttatggataactcagggaaagtttggctaatacgtacgagtcacattacttcacacagcaattgttattcgcaatctgtcgcgtctaccgcattcatgaaacaaacattaattataaatgcgcgcgcgcgcactcatctgcgaaataactaaactaattactcagcactcaatggtaaacttatgcgtctgcgtacttctgtcttcggacgatgcgcttacgcatgattcgtttaactgcaacatgagagacattgagcacgcagtctttcgatccttcgtgattgattgacatctacgctgagcagactttaagattcttaatcttgaagcatgtcatacaagcatctatagcaccaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatatcatctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgttatcatatacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatattttatatatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagtaggcgagtggtgaaatgcattgacccttgcaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtataccatcattatacaatacacatacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgtagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatccgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaacttacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Specimen D3

E. aculeatum D3 E. aculeatum D3
Species Rotaliida > Elphidiidae > Elphidium > Elphidium aculeatum
Isolate number D3
Collector Jan Pawlowski
Identifier Loic Pillet
Collected on September 2008
Location Mediterranean Sea, Porquerolles, France
Latitude, Longitude 43.0012, 6.20422

Barcode sequences

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaaaaggtatgtttgtgtctagtatgctataatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattggaagtaacgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Other sequences

SSU total

>Elphidium aculeatum | genomic DNA | D3.1 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagcatgcaagtggttattttttaataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggtttaactaatttacgaacaacggataactcagggaaagtttggctaatacgtacgaacaattattattgcatacagttacgcatgaatgagattgtatacgtgcgcgtgcttgcaccgcacacggcagatattgtgtatttataacacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtagttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatatcatctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgttatcatatacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatatttttatatatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtataccatcattatacaatacacatacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgtagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU total

>Elphidium aculeatum | genomic DNA | D3.2 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttattttttaataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggtttaactaaatttacgaacaacggataactcagggaaagtttggctaatacgtacgaacaattattattgcatacagttacgcatgaatgagattgtatacgtgcgcgtgcttgcaccgcacacggcagatattgtgtatttataacacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgttatcatatacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatatttttatatatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagcaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtataccatcattatacaatacacatacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgtagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU total

>Elphidium aculeatum | genomic DNA | D3.3 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggctattttttaataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagagagctgcttaatacagtcacacttgtcttgactcggtttaactaatttacgaacaacggataactcagggaaagtttggctaatacgtacgaacaattattattgcatacagttacgcatgaatgagattgtatacgtgcgcgtgcttgcaccgcacacggcagatattgtgtatttataacacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatatcatctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgttatcatatacgtgtatctgaatgttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatatttttatatatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtataccatcattatacaatacacatacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgtagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaactacctttaaaaggtatgtttgtgtctagtatgctataatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttttatgtatcgtacctctgtgtatgttcaaaaatacctaccctgagaatgggcgggtaatcaattggaagtaacgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatattttcaatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI