Allogromia laticollaris, strain CSH

Order “"monothalamids"” > Family “Clade M” > Genus “Allogromia

Original description
Further reference McEnery, M., E., Lee, J., J., 2007, J. Eukaryot. Microbiol., 23, 94-108
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

Sphaerical orange to yellowish test with thin proteinaceous wall and terminal aperture.

Representative pictures

Allogromia laticollaris Allogromia laticollaris Allogromia laticollaris

Specimens

Specimen 12953

Allogromia laticollaris_12953
Species "monothalamids" > Clade M > Allogromia > Allogromia laticollaris, strain CSH
Isolate number 12953
Collector John J. Lee
Description strain CSH

Barcode sequences

SSU partial

>Allogromia laticollaris | genomic DNA | 12953 | taxon:71427 | 1 | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccgaacacgcnnattattgacaggttttnnnaagactatgtataatttttttttaaaattatatatagcaattcttatatcaaatatgctagtcctttcatgattgcgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactataatgagtatatattgaatactttgtttgcacataaagttgctgcattgttttttaactttgcacctttattgttgcacggtattcttttaaatatactctgaaggcaacgaacgtgaccgcaacatcttgttgcataatcttatttatgctaactagatggaccgctggatcttttctaaacagaggaagattgcggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgattattgcagtaagcatctatataggatttttataatccgcaggaattaaataaatatataattttttatatatttatcctgtttaaccaactttgaaagtaagttggtaatcaattcgaagtaatgatttccttttgcacaataataatattttattcgattaatctttatcttttttgattttgtattaaagttaaaatatgtgctcttttatttcatggtggggactgaccattgttaattgttggtcacgtctcaactaggaatgccttgtactggtcttggttcaacaaaccaccgggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactattctgtgagtatacaggacgggaactctatcttctgattgagttctataagaatgtacgcgaacag

See sequence on NCBI

SSU partial

>Allogromia laticollaris | genomic DNA | 12953 | taxon:71427 | 2 | USA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccgaacacgctgaggattgacaggtttttataagactatgtataatttttttttaaaattatatatagcaattcttatatcaaatatgctagtcctttcatgattgcgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactataatgagtatatattgaatactttgtttgcacataaagttgctgcattgttttttaactttgcacctttattgttgcacggtattcttttaaatatactctgaaggcaacgaacgtgaccgcaacatcttgttgcataatcttatttatgctaactagatggaccgctggatcttttctaaacagaggaagattgcggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgattattgcagtaagcatctatataggatttttataatccgcaggaattaaataaatatataattttttatatatttatcctgtttaaccaactttgaaagtaagttggtaatcaattcgaagtaatgatttccttttgcacaataataatattttattcgattaatctttatcttttttgattttgtattaaagttaaaatatgtgctcttttatttcatggtggggactgaccattgttaattgttggtcacgtctcaactaggaatgccttgtactggtcttggttcaacaaaccaccgggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactattctgtgagtatacaggacgggaactctatcttctgnttgagttctataagaatgtacgcgaacag

See sequence on NCBI

Specimen 12954

Allogromia laticollaris_12954
Species "monothalamids" > Clade M > Allogromia > Allogromia laticollaris, strain CSH
Isolate number 12954
Collector John J. Lee
Description Strain CSH

Barcode sequence

SSU partial

>Allogromia laticollaris | genomic DNA | 12954 | taxon:71427 | 3 | USA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccgaacacgctgangattgacaggtttttataagactatgtataatttttttttaaaattatatatagcaattcttatatcaaatatgctagtcctttcatgattgcgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactataatgagtatatattgaatactttgtttgcacataaagttgctgcattgttttttaactttgcacctttattgttgcacggtattcttttaaatatactctgaaggcaaacgaaacgtgaccgcaacatcttgttgcataatcttatttatgctaactagatggaccgctggatcttttctaaacagaggaagattgcggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgattattgcagtaagcatctatataggatttttataatccgcagggaattaaataaatatataattttttgtatattttatcctgtttaaccaacttttgaaagtaagttggtaatcaattcgaagtaatgatttccctttttgcacaataataatattttattcgattaatctttatcttttttgattttgtattaaagttaaaatatgtgctcttttatttcatggtggggactgaccattgttaattgttggtcacgtctcaactaggaatgccttgtactggtcttggttcaacaaaccaccaggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactattctgtgagtatacagggcgggaactctatcttnnattgagttctataagaatgtacgcgaacagtgnnnnnnnnnnaagagaagtcgaacaaggcaaagggcgaattcg

See sequence on NCBI

Specimen 647

Species "monothalamids" > Clade M > Allogromia > Allogromia laticollaris, strain CSH
Isolate number 647
Collector John J. Lee
Collected on October 1997

Barcode sequence

SSU partial

>Allogromia laticollaris | genomic DNA | 647 | taxon:71427 | 2 | single cell | USA | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccgaacacgctgaggatcgacaggtttttataagactatgtataatttttttttaaaattatatatagcaattcttatatcaaatatgctagtcctttcatgattgcgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactataatgagtatatattgaatactttgtttgcacataaagttgctgcattgttttttaactttgcacctttattgttgcacggtattcttttaaatatactctgaaggcaacgaacgtgaccgcaacatcttgttgcataatcttatttatgctaactagatggaccgctggatcttttctaaacagaggaagattgcggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgattattgcagtaagcatctatataggatttttataatccgcaggaattaaataaatatataattttttatatatttatcctgtttaaccaactttgaaagtaagttggtaatcaattcgaagtaatgatttccttttgcacaataataatattttattcgattaatctttatcttttttgattttgtattaaagttaaaatatgtgctcttttatttcatggtggggactgaccattgttaattgttggtcacgtctcaactaggaatgccttgtactggtcttggttcaacaaaccaccaggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactattctgtgagtatacaggacgggaactctatcttctgattgagttctataagaatgtacgcgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI