Cibicides refulgens

Order “Rotaliida” > Family “Incertae sedis” > Genus “Cibicides

Original description de Montfort, D., P., 1808, 3, Paris, France, F. Scholl, 123
Further reference Schweizer, M., Pawlowski, J., Kouwenhoven, T., van der Zwaan, B., 2009, J. For. Res., 39, 300-315 (6.48 MB)
Further reference Langer, M. R., 1988, Rev. de Paléobiol. n° spécial 2, 827-832

General description

Morphologically close to C. lobatulus, but its umbilical side is higher convex than in C. lobatulus. Flat spiral side and angular periphery.

Representative pictures

Cibicides refulgens_C78

Specimens

Specimen C171

Species Rotaliida > Incertae sedis > Cibicides > Cibicides refulgens
Isolate number C171
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on November 2001
Depth <10m
Location Mediterranean Sea, Marseille, France
Latitude, Longitude 43.18, 5.22

Barcode sequences

SSU partial

>Cibicides refulgens | genomic DNA | C171.2 | D. Longet C171 (UniGE) | taxon:212459 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattacaccctctctcgtagatgtgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtttatgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttatgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacggaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattacttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Cibicides refulgens | genomic DNA | C171.4 | D. Longet C171 (UniGE) | taxon:212459 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattacactctctctcgtagatgtgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtttatgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacacggcatgcgcgagtccatttattcattatccttcgggttatgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattacttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Cibicides refulgens | genomic DNA | C171.6 | D. Longet C171 (UniGE) | taxon:212459 | small subunit ribosomal RNA attgacaggcaatattaatattacactctctctcgtagatgtgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggaactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtttatgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttattaaaccaagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgaagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttatgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatataccgcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattacttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen C172

Species Rotaliida > Incertae sedis > Cibicides > Cibicides refulgens
Isolate number C172
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on September 2003
Depth <10m
Location Mediterranean Sea, Marseille, France
Latitude, Longitude 43.18, 5.22

Barcode sequences

SSU partial

>Cibicides refulgens | genomic DNA | C172.1 | D. Longet C172 (UniGE) | taxon:212459 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattacactctcttcgtagatgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtgtttgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagcgagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttttgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattacttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Cibicides refulgens | genomic DNA | C172.6 | D. Longet C172 (UniGE) | taxon:212459 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattacactctcttcgtagatgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtttatgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggccgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttttgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgcatcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattacttgcacgcctatggaaacttaaac

See sequence on NCBI

Specimen C173

Species Rotaliida > Incertae sedis > Cibicides > Cibicides refulgens
Isolate number C173
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on September 2003
Depth <10m
Location Mediterranean Sea, Marseille, France
Latitude, Longitude 43.18, 5.22

Barcode sequences

SSU partial

>Cibicides refulgens | genomic DNA | C173.1 | D. Longet C173 (UniGE) | taxon:212459 | small subunit ribosomal RNA annaggtaaatagntgtttcaanngnnncnntcncaattccacacaacatacnnnncggattcgattagctatgcgtatatttgctatacacacgctttagaatttattctcctttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttctgcgttaaaaatttattactgcttcgtgctgtaattatttttttacacacacacacacacacatacgcacatgttgtatgccacgtaaataatttttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattatatatattttatcacgcataaatatacacacacacacatacacactcacgtatatacatgcggtcagtatatatacatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttttcattaaattgcaaatttcctcaacctacaaaatgacttggcttgagctcgtattttttatacgctcgcctaacttttttcgtacggtctcgatggacgtttcatttaaatttttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactatgttatactatccgcagcatatgtcttcgggcattttgtctgtcgtgtttagttaacaatttcggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattacactctcttcgtagatgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgcctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtgtttgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacatgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttttgttttaaatgtgtatctctgcacgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgaggactgggaacgcatataatttcgattatttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaac

See sequence on NCBI

SSU partial

>Cibicides refulgens | genomic DNA | C173.1b | D. Longet C173 (UniGE) | taxon:212459 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattacactctcttcgtagatgtgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgcctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtgtttgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacatgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttttgttttaaatgtgtatctctgcacgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattatttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaac

See sequence on NCBI

SSU partial

>Cibicides lobatulus | genomic DNA | 576 | J. Pawlowski 576 (UniGE) | taxon:325267 | small subunit ribosomal RNA accgggtccggacacactgaggattgacaggcaatattaatacgttttgcttcggtaaacgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcatcgcactttgacccctttctttaattagagagcgcgtgtcttagttttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgcgtcaatttttacgaattgcgcgcatttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgca

See sequence on NCBI

Specimen C208

Species Rotaliida > Incertae sedis > Cibicides > Cibicides refulgens
Isolate number C208
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on September 2003
Depth <10m
Location Mediterranean Sea, Marseille, France
Latitude, Longitude 43.18, 5.22

Barcode sequence

SSU partial

>Cibicides refulgens | genomic DNA | C208.6 | F. Sinniger C208 (UniGE) | taxon:212459 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattacactctcttcgtagatgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtttatgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttatgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattacttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtgtaaca

See sequence on NCBI

Specimen C218

Species Rotaliida > Incertae sedis > Cibicides > Cibicides refulgens
Isolate number C218
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on April 2004
Location Mediterranean Sea

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatactacactctcttcagagatgtgtattttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtttatgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttatgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattacttgcacacctatgaaaactaaaccgaaaag

See sequence on NCBI

Other sequence

SSU total

>Cibicides refulgens | genomic DNA | C218 | taxon:212459 | small subunit ribosomal RNA tatattaacccgacagtttaaataagtgttaaatgctacattattaaacttacatcatatcacgcataccacgattttgtttaccgtagtaacaatttcagcgtgacgcacatatatcttcgcgatatagtgaatcactgaaatttacccattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataatatacaatgaaattttcatttcgaaatatatactcgctcgcgggtgtatgtgacggccgaattttttatttttattatttttttttgttgccttcacacgcactacaaaaatttatatattgatttctctgtatcgcttattcttaaggacaakgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtacattttacaccacacacacacacacacacacatacacnnantatatatttttgtatctacgctgtgtawcaacaatacatacatcmttactcmkcactcaatggtaakcttwggctgcgttcgcgtagccagttyaaagttwaactgcaacatgagagacattgacgcacgcacgtgttgtatcttcgggtacytcacatcacgctgagcagactakgckaagtttastttgcgaagcatrtcatacaagcatmtacagcaycaagtcacagggygtggswrtgtgtattttttgmacctycmamgcastcmcgcawassgaagagtagtttmtgatcccatagaaggagcrccgcacaatgagagaccgctcttagttttaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccgtacaatactaattgtattttacaatgcgttaaaccaattcacataccaacaagtttatacataatattacacatataacacttctattttttctgttgatgttaatttacatcaattagaacatacatacatatccttgttcgttgtttatttatcagcatcataatattattattatattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctctcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaatatttcacnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttgttgcggttaagaggctcgtagttggattgaactgcacgtatgcgaatgaatttctcattctgtttggaagtttttttacgctttatttaattctgaattatttattgcgttcgacgctgttacaaaatttttattttttacacgggacaaatatacatatacgtatatatcacacacacacatacccattcgatatatataagctatgcgtatatttgcgtatatttgctatacacacgctttagaatttattctcctttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttctgcgttaaaaatttattactgcttcgtgctgtaattatttttcacacacacacacacacacacacacacatacgcacatgttgtatgccacgtaaataatttttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagagagagcagttgggtagggtatactctttgtgattatatatattttatcacgcataaatatacacacacacacatacacactcacgtatatacatgcggtcagtatatatacatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttttcattaaattgcaaatttcctcaacctacaaaatgacttggcttgagctcgtattttttatacgctcgcctaacttttttcgtacggtctcgatggacgtttcatttaaatttttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactatgttatactatccgcagcatatgtcttcgggcattttgtctgtcgtgtttagttaacaatttcggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatactacactctcttcagagatgtgtattttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtttatgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttatgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattacttgcacacctatgaaaactaaaccgaaaag

See sequence on NCBI

Specimen C78

Cibicides refulgens_C78
Species Rotaliida > Incertae sedis > Cibicides > Cibicides refulgens
Isolate number C78
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on November 2002
Depth <10m
Location Mediterranean Sea, Planier Canyon, France
Latitude, Longitude 43.02, 5.12

Barcode sequence

SSU partial

>Cibicides refulgens | genomic DNA | C78 | J.-P. Gillig C78 (UniGE) | taxon:212459 | small subunit ribosomal RNA aaatcttaccgggtccggacacactgaggattgacaggcaatattaatattacactctcttcgtagatgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtttatgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttatgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtcctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagttgagggactgggaacgcatataattcgattacttgcacacctatggaacttaacgaacagtgtgtct

See sequence on NCBI