Ammonia aberdoveyensis T2

Order “Rotaliida” > Family “Rotaliidae” > Genus “Ammonia

Original description Haynes, J., R., 1973, Bull. Br. Mus. (Nat. Hist.) Zool. Suppl. 4, 1-245
Revision Hayward, B., W., Holzmann, M., Grenfell, H., R., Pawlowski, J., 2004, Mar. Micropal., 50, 237-271 (1.58 MB)

General description

See the paper of Hayward et al., 2004 for a morphological characterization.

Representative pictures

Ammonia aberdoveyensis T2_490, spiral view Ammonia aberdoveyensis T2_490, umbilical view

Specimens

Specimen 243

Ammonia aberdoveyensis T2_243, spiral view Ammonia aberdoveyensis T2_243, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia aberdoveyensis T2
Isolate number 243
Collector Maria Holzmann
Identifier Maria Holzmann
Collected on June 1995
Habitat salt marsh
Depth <1m
Location Adriatic Sea, Lagoon of Venice, Italy

Barcode sequences

SSU partial

>Ammonia sp. 243 | genomic DNA | 243 | taxon:944410 | 7 | France:Camargue, Le Boucanet | Aug-1995 | Maria Holzmann | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctcattgcagttcgctgcatgagctgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtggatttcgcgtggtagtgaccccctgtttaacgacaggcgtgtgtcgcacacgagtacctacgcactggtctcagatagcaacgaacgtgaccgtattctattgttgcagtgaaatgtgccttctgggtacgacccactgcttagtatatgtacgtgcttcggcgcgaacaatatacattaaactatagagaccgctgtttcttctttaaaccagaggaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgccgcatgcatgtgctcttcggggtacacgcattgctgttgcgaccacgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacaactaaatgtacgcgcatgttctacccggctcgcctttgtgtgagtgcagtgcgtagcttgttgtttcgtacgtgccactccgtattaattcgtacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctctggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatgctatgaatctataggactgccaaagctttttggagcttagtggaaatatatatgnnnnnnnngatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 243 | genomic DNA | 243 | taxon:944410 | 5 | France:Camargue, Le Boucanet | Feb-2001 | Maria Holzmann | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctcattgcagtccgctgcatgagctgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtggatttcgcgtggtagtgaccccctgtttaacgacaggcgtgtgtcgcacacgcgtacctacgcactggtctcagatagcaacgaacgtgaccgtattctattgttgcagtgaaaatgtgccttctgggtacgacccactgcttagtatatgtacgtgcttcggcgcgaacaatatacattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacgggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgtggacgccgcatgcatgtgctcttcggggtacacgcattgctgttgcgaccacgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacaactaaatgtacgcgcaggttctacccggctcgcctttgtgtgagtgcagtgcgtggcttgttgtttcgtacgtgccactccgtattaattcgtacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctctggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgggttatgctatgaatctataggactgccaaagtacgcgtttcggcgccgcttagtggaaatatatatnnnnnncgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. | genomic DNA | VS13 | taxon:43993 | 6 | LSU rRNA | LSU rRNA | large subunit ribosomal RNA cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggatgccaatatataatatgtacctcgcgtgcataaattagcccgtcgatactatcctagcgtatgtcaccggtcttcgggtcggtactcaaatacgcgggaattgtagcatcgtaataattaaaaaatatacagcacacacacacacacacacataagaacccacgccaacacagcgtacaccacttgtaaacacacagcgtctccgcgttggaaagcaagtatatatcctctttggatatgccatagagtgtgacagccacgtttcaccctttagtacgcacacacatacaccaatggcgcggcgtgcgagtgcacaacgtatatatactataacctgagtcgagttattt

See sequence on NCBI

Specimen 490

Ammonia aberdoveyensis T2_490 Ammonia aberdoveyensis T2_490
Species Rotaliida > Rotaliidae > Ammonia > Ammonia aberdoveyensis T2
Isolate number 490
Collector Maria Holzmann
Identifier Maria Holzmann
Collected on October 1995
Habitat Brackish estuary
Depth <1m
Location Golf de Morbihan, Bretagne, France

Barcode sequences

SSU partial

>Ammonia sp. 490 | genomic DNA | 490 | taxon:944411 | 9 | France:Bretagne | Feb-1996 | Maria Holzmann | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctcattgcagtgcttcggcgccgcatgggctgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtggatttcgcgtggtagtgaccccctgtttaaccgcaggcgtgtgtcgcacacgcgtaccacgcactggtctcagatagcaacgaacgtgaccgtattctattgttgcagtgaaatgtaccttcgggtacgacccactgcttagtgtgagcttgcctcgtgtaagcatcacacattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgtggacgccgcgtgcatgtgctcttcggagtacacgcattgctgttgcgaccacgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacactaaatgtacgcgcaggtctacccggctcgcctttgtgtgagtgcagtgcgtagcttgttgtttcgtacgtgccactccgtattaattcgtacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctctggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatgctatggatctataggactgccaaagngcgcgcttcggcgccgcgctnagtggaaatatnnnnnnnnnnnnnnnnntaaangaaagagaagtccgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 490 | genomic DNA | 490 | taxon:944411 | 8 | France:Bretagne | Feb-1996 | Maria Holzmann | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctcattgctgcgtgcttcggcgcgtgcattgagctgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtggatttcgcgtggtagtgaccccctgtttaaccgcaggcgtgtgtcgcacacgcgtaccacgcactggtctcagatagcaacgaacgtgaccgtattctattgttgcagtgaaatgtaccttcgcgggtacgacccactgcttagtatatgtacgtgcttcggtgcgaacaatatacattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgccgcgtgcatgtgctcttcggagtacacgcattgctgttgcgaccacgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacactaaatgtacgcgcaggtctacccggctcgccttttgtgtgagtgcagtgcgtagcttgttgtttcgtacgtgccactccgtattaattcgtacgtggggatagatcgttgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctctggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatgctatgaatctataggactgccaaagtgcgcgcttcggcgccgcgcttagtggaaatatatatgantagcgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. | genomic DNA | FS 21 (from Bretagne, France) | taxon:43993 | 1 | LSU rRNA | LSU rRNA | large subunit ribosomal RNA cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggatgccaatataaaatatgtacctcgcgtgcataaattagcccgtcgatactatcctagcgtatgtaccggtcttcgggtcggtactcaaatacgcgggaattgtagcatcgtaataaaaaaaatatacagcacacgcacacacacacacataagaacccacgccaatgcgtacaacttgtaaacacacagcgtctccgcgttggaaagcaagtatatatcctctttggatatgccatagagtgtgacagccacgtttcacccttaagtacgcacacacacacacatgaacccaccaaatggcgcggcacgtgcaagtgcaccgtatatataatataacctgagtcgagttattt

See sequence on NCBI