Ammonia aoteana T5

Order “Rotaliida” > Family “Rotaliidae” > Genus “Ammonia

Revision Hayward, B., W., Holzmann, M., Grenfell, H., R., Pawlowski, J., 2004, Mar. Micropal., 50, 237-271 (1.58 MB)
Original description Finlay H. J., 1940, Transactions of the Royal Society of New Zealand, 69, No.4, 448-221

General description

See the paper of Hayward et al., 2004 for a morphological characterization.

Representative pictures

Ammonia sp. T5_108; umbilical view Ammonia sp. T5_108; spiral view

Specimens

Specimen 108

Ammonia sp. T5_108, spiral view Ammonia sp. T5_108, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia aoteana T5
Isolate number 108
Collector Bruce Hayward
Identifier Maria Holzmann
Collected on March 2000
Habitat salt marsh
Location New Zealand, Pollen Island

Barcode sequences

SSU partial

>Ammonia sp. 108 | genomic DNA | 108 | marine sediment | taxon:155798 | 13 | true | New Zealand:Pollen Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagnnnnggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgcgcatatactctctcgtggagtatatacgttcaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagctcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtagactcgtatggtagtgaccccctcttaattgaggcgcgtgtcgcacatacgttatacgcactggtctcagatagcaacgaacgtgaccgtactctattgttgcagtgaaaatgttgcttcggcaacaaacccactgcttagtacgcgtgtatttcggtacgcgccgtacattaaactatagagacccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcaccgtgcatctaacccaatgtgcgcggacgccgcgtatacgtgttttcctttcgggactcatgtatattgctgagcgaccgcgccgaacctacttcgaaagtaaaatttctctgtgggtaatccattagaagtaatgactcgcatagaccatggcacactataaaagtacgcgcaggttctacccggctcgcctttgtgtgagtgcagtgcgtagcttgttgtttcgtacgtgccacctcgtattaattcgtacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctctggttcaacataccacccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaagctctcacgctctcgcgcggaagcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 108 | genomic DNA | 108 | marine sediment | taxon:155798 | 3 | true | New Zealand:Pollen Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcngtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgcgcatatactctctcgtggagtatatacgttcaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagctcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtagactcgtatggtagtgaccccctcttaattgaggcgcgtgtcgcacatacgttatacgcactggtctcagatagcaacgaacgtgaccgtactctattgttgcagtgaaaatgttgccctcgcgctaacaaaccccactgcttagtacgcgtgtatttcggtacgcgccgtacattaaactatagagacccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcaccgtgcatctaacccaatgtgcgcggacgccgcgtatacgtgttttcttcgggactcatgtatattgctgagcgaccgcgccgaacctacttcgaaagtaaaatttctctgtgggtaatccattagaagtaatgactcgcatagaccatggcacactataaaagtacgcgcaggttctacccggctcgcctttgtgtgagtgcagtgcgtagcttgttgtttcgtacgtgccacctcgtattaattcgtacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctctggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaagctattcgctctcgggcggaagcttagtggaaatatatatggatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. 108 | genomic DNA | 108 | taxon:155798 | 7 | single cell | true | New Zealand:Pollen Island | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaacaaaatacatgtgcctcgcgcgcatgatttagcccgtcgatactatcctagcatattaccggtctcggccggtaactcaatatgcgggaattgtagcatcgtaataataaaaaaaatatatatgtgcacgcacacacacacacacccaccgcgtacgtacttgtaaacacacagcgtctccgcgttggaaagcaagtttatatcctctttggatatgccatagagtgtgacagccacgtttcactcataaccgtacgcacacacacacgccccgtgcactaatatatatttctataacctgagtcgagttattt

See sequence on NCBI