Leptohalysis scotti

Order “Textulariida” > Family “Incertae sedis” > Genus “Leptohalysis

Original description Chaster, G.,W., 1892, First Report Southport Society of Natural Science, 54-72
Description Höglund, H., 1947, Zoologiska Bidrag fran Uppsala, 26

General description

Elongate and slender test composed of numerous chambers successively increasing in size as added.

Representative pictures

Leptohyalis scotti_12285

Specimens

Specimen 12285

Leptohyalis scotti_12285
Species Textulariida > Incertae sedis > Leptohalysis > Leptohalysis scotti
Isolate number 12285
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Leptohyalis scotti | genomic DNA | 12285 | marine sediment | taxon:998810 | 4 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattattttacttcatgtaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattattttatataatataaattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgtcttttatggcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgnncngtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Leptohyalis scotti | genomic DNA | 12285 | marine sediment | taxon:998810 | 5 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaaattgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattattttacttcatgtaaaattcaattattgtgttaaatatgctagtccttttcnngattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattattttatataatataaattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgtcttttatggcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12287

Leptohyalis scotti_12287
Species Textulariida > Incertae sedis > Leptohalysis > Leptohalysis scotti
Isolate number 12287
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Leptohyalis scotti | genomic DNA | 12287 | marine sediment | taxon:998810 | 7 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatctaccgggtccggacacactgaggattgacaggtattatcaataattatttttacatttttatgttaaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcgatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattttttttataaaatattattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgtcttttatggcattcttatacagtattttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacctctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Leptohyalis scotti | genomic DNA | 12287 | marine sediment | taxon:998810 | 8 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagnatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattatttttgcatttttatgttaaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattatttattaatataattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgtcttttatggcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12288

Leptohyalis scotti_12288
Species Textulariida > Incertae sedis > Leptohalysis > Leptohalysis scotti
Isolate number 12288
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Leptohyalis scotti | genomic DNA | 12288 | marine sediment | taxon:998810 | 25 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattatttttgcatttttatgttaaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttatttttttataaaatataattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagttcctttgtatagtttgtcttttatggcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Leptohyalis scotti | genomic DNA | 12288 | marine sediment | taxon:998810 | 26 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattatttttgcatttttatgttaaaaattcaatcattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttatttttttataaaatataattaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttatttcgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagttcctttgtatagtttgtcttttatggcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12290

Leptohyalis scotti_12290
Species Textulariida > Incertae sedis > Leptohalysis > Leptohalysis scotti
Isolate number 12290
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Leptohyalis scotti | genomic DNA | 12290 | marine sediment | taxon:998810 | 29 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattatttttgcatttttatgttaaaaattcaatcattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttatttttttataaaatataattaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttatttcgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggcttcttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgtcttttatgtcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Leptohyalis scotti | genomic DNA | 12290 | marine sediment | taxon:998810 | 30 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattattttacttcatgtaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattatttattaatataattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgtcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgtcttttatggcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12291

Leptohyalis scotti_12291
Species Textulariida > Incertae sedis > Leptohalysis > Leptohalysis scotti
Isolate number 12291
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequence

SSU partial

>Leptohyalis scotti | genomic DNA | 12291 | marine sediment | taxon:998810 | 16 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattatttttacatttttatgttaaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattttttttataaaatataattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcctcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgtcttttatggcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcgntttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12292

Leptohyalis scotti_12292
Species Textulariida > Incertae sedis > Leptohalysis > Leptohalysis scotti
Isolate number 12292
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Leptohyalis scotti | genomic DNA | 12292 | marine sediment | taxon:998810 | 33 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattatttttgcatttttatgtaaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattatttattaatataattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgccttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcttcgaaagtaagtggggaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgacttttatgtcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Leptohyalis scotti | genomic DNA | 12292 | marine sediment | taxon:998810 | 34 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacacgagaaatcttaccgggtccggacacactgaggattgacaggtattatcaataattatttttgcatttttatgtaaaaattcaattattgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttaaaattatgtgctttaatattgacccctcaatttttaattgagtgtgttgtctttattggtacttctaagctctgaaagcaacgaacgtgaccgcaaccctttgttgcctttactaaaattttattatttattaatataattaaaaaaggctttttaaactagggggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgatttttgcagtgagcatctcatttttaatacatcgcttgcatgatgctttatatttaaatttatttttatttattttgttcatttttgcgcgataaagcctgcttcgaaagtaagtgggtaatcaattagaagtaaagatttccaaattttatagcacaaatatatacggcatttttacccggctttttcatttcgaattagttttgtgtgtattaatgagtttctttgtatagtttgacttttatgtcattcttatacagtactttatcgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtttcaactaggaatgccttgtacggatctttggttcaacaaancatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatagacttctctgtgagtttgagggactggataacttatacttctatggaaacttaaacgaacagtgtggtccaaaggaaagagaagtcgaacaaggca

See sequence on NCBI