Eggerelloides scaber

Order “Textulariida” > Family “Incertae sedis” > Genus “Eggerelloides

Original description Williamson, W., C., 1858, London: Ray Society
Description Höglund, H., 1947, Zoologiska Bidrag fran Uppsala, 26

General description

Agglutinated test, early stage trochospiral, later triserial.

Representative pictures

Eggerelloides scaber, Denmark, Aarhus Eggerelloides scaber, Denmark, Aarhus

Specimens

Specimen 12301

Eggerelloides scabrum_12301
Species Textulariida > Incertae sedis > Eggerelloides > Eggerelloides scaber
Isolate number 12301
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Eggerelloides scaber | genomic DNA | 12301 | marine sediment | taxon:160331 | 16 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataaattaaaatatattatatatattttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttattaatttaacgtgtgttgttaggcgttaactttgacccctaattttaataaaattagtgcgtgtcttagtttttattgcttttaactcacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttatatttatttatttatttacgcctcgcgcgtaaaaaaattttaaaaaaaaaggctttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttaattacaccgctttgcgcgtgtgaacacacaaattatttatttaatttgtatgttttttacattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcgattagaagtaatgatttccctaattttaatagcacacatatatacggcatctttacccgggtttaagcttttgtcttttacttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatactgtaaaaaaataatttttattaattattttttactacccatctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerelloides scaber | genomic DNA | 12301 | marine sediment | taxon:160331 | 17 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataaattaaaatatattatatatattttatgttaaatatgctagtcctttnctnnattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttattaacttaacgtgtgttgttaggcgttaactttgacccctaattttaataaaattagtgcgtgtctttagtttttattgcttttaactcacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttatatatttatttatttacgcctcgcgcgtaaaaaaaataataaaaaaaaggctttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttaattacaccgctttgcgcgtgtgaacatcaaattatttatttaatttgtatgttttttacattgcgcacggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccctaattttaatagcacacatatatacggcatctttacccgggtttaagcttgtcttttacttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatactgtaaaaaaataatttttattaattattttttactacccatctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12302

Species Textulariida > Incertae sedis > Eggerelloides > Eggerelloides scaber
Isolate number 12302
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Eggerelloides scaber | genomic DNA | 12302 | marine sediment | taxon:160331 | 1 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataaattaaaatatattatatatattttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttattaatttaacgtgtgttgttaggcgttaactttgacccctaattttaataaaattagtgcgtgtcttagtttttattgctcttaactcacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctctatatatttatttatttacgcctcgcgcgtaaaaaaaataataaaaaaaaaggctttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttaattacaccgctttgcgcgtgtgttaacacacaaattatttatttaatttgtatgttttttacattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccctaattttaatagcacacatatatacggcatctttacccgggtttaagcttttgtcttttactcttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatactgtaaatttttttactacccatctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerelloides scaber | genomic DNA | 12302 | marine sediment | taxon:160331 | 2 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataaattaaaatatattatatatattttatgttaaatatgctagtcccttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttattaatttaacgcgtgttgttaggcgttaactttgacccctaattttaataaaattagtgcgtgtctttagtttttattgcttttaactcacacaattaagtcctgaaagcaacgaacgtgaccacaacctcttgttgcctttatatatttatttatttacgcctcgcgcgtaaaaaaattaaaaaaaaaaaaggctttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttaattacaccgctttgcgcgtgtgaacatcaaattatttatttaatttgtatgttttttacattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccctaattttaatagcacacatatatacggcatctttacccgggtttaagcttgtcttttacttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatactgtaaaaaaataatttttattaattattttttactacccatctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerelloides scaber | genomic DNA | 12302 | marine sediment | taxon:160331 | 3 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataaattaaaatatattatatatattttatgttaaatatgctagtcccttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttattaatttaacgcgtgttgttaggcgttaactttgacccctaattttaataaaattagtgcgtgtctttagtttttattgcttttaactcacacaattaagtcctgaaagcaacgaacgtgaccacaacctcttgttgcctttatatttatttatttacgcctcgcgcgtaaaaaaattaaaaaaaaaaggctttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttaattacaccgctttgcgcgtgtaaaaatttatttttttacattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccctaattttaatagcacacatatatacggcatctttacccgggtttaagcttttgtcttttacttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatactgtaaatttttttactacccatctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 12303

Species Textulariida > Incertae sedis > Eggerelloides > Eggerelloides scaber
Isolate number 12303
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2010
Location Denmark, Aarhus Bay
Latitude, Longitude 56.09, 10.28

Barcode sequences

SSU partial

>Eggerelloides scaber | genomic DNA | 12303 | marine sediment | taxon:160331 | 5 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcagcgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataaattaaaatatattatatattttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgnggngngatctgtctgcttaattgcgtttcactaagggcttattaatttaacgtgtgttgttaggcgtaactttgacccctaattttaattaattagtgcgtgtcttagtttttattgcttttaactcacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttatatatttatttatttacgcctcgcgcgtaaaaaaattaaaaaaaaaaaaggctttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttaattacaccgctttgcgcgtgtgaacatcaaattatttatttaatttgtatgttttttacattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccctaattttaatagcacacatatatacggcatctttacccgggtttaagcttgtcttttacttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatactgtaaatttttttactacccatctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerelloides scaber | genomic DNA | 12303 | marine sediment | taxon:160331 | 6 | Denmark:Aarhus Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaataaattaaaatatattatatatattttatgttaaatatgctagtcctttcatgattatgnnataggtggtgcatggccgtccttagttcgtggagtgatctgtctgcttaattgcgcttcactaagggcttattaatttaacgtgtgttgttaggcgttaactttgacccctaattttaataaaattagtgcgtgtcttagtttttattgcttttaactcacacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttatatttatttatttacgcctcgcgcgtaaaaaaattaaaaaaaaaggctttttaaactagagggaccgctgtaacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttaattacaccgctttgcgcgtgtgaacatcaaattatttatttaatttgtatgttttttacattgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccctaattttaatagcacacatatatacggcatctttacccgggtttaagcttgtcttttacttttgtgcgtatcgatgttttttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggatactgtaaaaaaataatttttattaattattttttactacccatctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI