Eggerella sp.

Order “Textulariida” > Family “Incertae sedis” > Genus “Eggerella

Original description of genus Cushman, J., A., 1911, Bull. United States Nat. Mus., 71, 1-108
Description of genus Loeblich, A., J., R., Tappan, H., 1988, vol.1-2, Van Nostrand, Reinhold, New York

General description

Agglutinated test, early stage trochospiral, later triserial; inflated chambers.

Representative pictures

Eggerella sp., Israel, Elat Eggerella sp., Israel, Elat Eggerella sp., Israel, Elat Eggerella sp., Israel, Elat

Specimens

Specimen 13131

Species Textulariida > Incertae sedis > Eggerella > Eggerella sp.
Isolate number 13131
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2010
Location Gulf of Eilat, Israel

Barcode sequences

SSU partial

>Eggerella sp. 13131 | genomic DNA | 13131 | marine sediment | taxon:998800 | 13 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggtttaatttgactcaacgcgagagatcttactgggtccgtacacactgaggattgacaggcaatattaaaaaaattgaatatatttaattatatattttaatttttttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttatatttataatacgtgtgttgacggcactttgtcccctttatgttgcattgaaatatatgtgatataaatgtgcgtgtcttagtatttagcttagtctcgcacaaatgagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttcaattacacaacattttaacattttatatgttattatgttaaaaaaaaggcctttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccgtaaatataaatttattttatatttaatagcacacatatatacggcatctttacccaacgcacagcttgtctgtcgttttgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerella sp. 13131 | genomic DNA | 13131 | marine sediment | taxon:998800 | 16 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggcttaatttgactcaacgcgagaaatcttactgggtccgtacacactgaggattgacaggcaatattaaaaaaattgaatatatataagtttatatatttaatttttatatgaaaatatgcgacctttttcnnnntatgagaaagggggcgnagcgccgctcatgattnnnngagagatctgtctctttaattgcgtttcactaagggctttatttataacacgtgtgggacggcactttgacccttttgttgcagtaaaatatatgngataaatatgtgcgtgtcttagtattgagcttagtctcgcacaaatgagtcctgaaagcaacgaaacgagaccgcaacctcttgttgcctttcaattacacaacattttaacattttatatgttattatgttaaaaaaaaggcctttaaactagagggaccgctgtactctttttaaaccagaagaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagagagcatctcattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccgtaaatataaatttattttatatttaatagcacacatatatacggcatctttacccaacgcacagcttgtctgtcgttttgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerella sp. 13131 | genomic DNA | 13131 | marine sediment | taxon:998800 | 14 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggcttaatttgactcaacgcgagaatcttactgggccgtacacactgaggattgacaggcaatattaaaaaaattgaatatatttaattatatattttaatttttttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttatattttataatacgtgtgttgacggcactttgacccctttatgttgcattgaaatatatgtgatataaatgtgcgtgtcttagtatttagcttagtctcgcacaaatgagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttcaattacacaacattttaacattttatatgttattatgttaaaaaaaaggcctttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccgtaaatataaatttattttatatttaatagcacacatatatacggcatctttacccaacgcacagcttgtctgtcgttttgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatcctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerella sp. 13131 | genomic DNA | 13131 | marine sediment | taxon:998800 | 15 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggttaatttcactcaacgcgagaaatcttactgggtccgtacacactgaggattgacattcaatattaaaaaaattgaatatatttaattatatattttaatttttttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgtttcttagttcgtggagtgatctgtctgctttaattgcgtttcactaagggcttatatttataatacgtgtgttgacgggcacttttgacccctttatgttgcattgaaatatatgtgatataaatgtgcgtgtcttagtatttagcttagtctcgcacaaatgtagtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttcaattacacaacattttaacattttatatgttattatgttaaaaaaaaggcctttaaactagagggacccgctgtaatctttttaaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccggggctgcacacgtgctacaatgattattgcagtgagcatcccattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccgtaaatataaatttattttatatttaatagcacacatatatacggcatctttacccaacgcacagcttgtctgtcgttttgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatcctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 13132

Species Textulariida > Incertae sedis > Eggerella > Eggerella sp.
Isolate number 13132
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2010
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

>Eggerella sp. 13132 | genomic DNA | 13132 | marine sediment | taxon:998801 | 20 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggcttaatttgactcaacgcgagaatcttactgggtccgtacacactgaggattgacaggcaatattaaaaaattgaatatatttaattatatattttaatttttttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttatatttataatacgtgtgttgacggcactttgacccctttatgttgcattgaaatatatgtgatataaatgtgcgtgtcttagtatttagcttagtctcgcacaaatgagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttcaattacacaacattttaacattttatatgttattatgttaaaaaaaggcctttaaactagagggaccgctgtaatctttttaaaccagagaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaaacctgcttcgaaagtaagngggaaatcaatttgaagtaatgatttnccgtaaaatataaatttattttatatttaatagcacacatatatatanncggcatctttacccaacgcacagcttgtctgtcgtttcgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccngaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatgctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 13133

Species Textulariida > Incertae sedis > Eggerella > Eggerella sp.
Isolate number 13133
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2010
Location Gulf of Eilat, Israel

Barcode sequences

SSU partial

>Eggerella sp. 13133 | genomic DNA | 13133 | marine sediment | taxon:998802 | 23 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctatgtgcgtctcggcgcgcatagctgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgcgtatatctgttgtggttcgtgaccccctcctcgcgaggcgcgtgtcgcacatatgttatatgcactggtctccgatagcaacgaacgtgaccgtactctattgttgcagcgacagtgcgtatctggtatgcgtcactacccactgcttagcgtgtacgtaccttcccggtgtgtcgtgcactaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcctcagtgcatatggtttcggctatgtgtatcttgagagcgaccgcgccgaacctgcttcgaaagtaaaatttctacgcgggtaatccattagaagtaatgactcgcttttagaccttggcacaatatatgtgcgcgcgggctaaccgttcgggccttctgtgccagttcagtgcttagctcgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacgcaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccaaagcatatactcttcggggtatgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerella sp. 13133 | genomic DNA | 13133 | marine sediment | taxon:998802 | 24 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctatgtgcgtctcggcgcgcatagctgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgcgtatatctgttgtggttcgtgaccccctcctcgcgaggcgcgtgtcgcacatatgttatatgcactggtctccgatagcaacgaacgtgaccgtactctattgttgcagcgacagtgcgtatcttgtatgcgtcactaccactgcttagcgtgtacgtatatcccgtatgcgtcgcgcactaaacctatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcctcagtgcgtatataccttcgggtgtatgtgtatcttgagagcgaccgcgccgaacctgcttcgaaagtaaaatttctacgcgggtaatccattagaagtaatgactcgctttagaccttggcacgatatatgtgcgcgcgggctaaccgttgtaacctctgtgttactccagtgcttagctcgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccaaagcatatactcttcggggtatgcgcttagtggaaatatatangaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 13136

Species Textulariida > Incertae sedis > Eggerella > Eggerella sp.
Isolate number 13136
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2010
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

>Eggerella sp. 13136 | genomic DNA | 13136 | marine sediment | taxon:998803 | 27 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgagaaatcttactgggtccgtacacactgaggattgacaggcaatattaaaaaaattgaatatatttaattatatattctaatttttttatgttaaatatgctagtcctttcatgattatgtgataggtggggcgtggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttatatttataatacgtgtgttgacggcactttgacccctttatgttgcattgaaatatatgtgatataaatgtgcgtgtcttagtatttagcttagtctcgcacaaatgagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttcaattacacaacattttaacattttatatgttattatgttaaaaaaaggcctttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaagcctgctccgaaagtaagtgggtaatcaattagaagtaatgatttcccgtaaatataaatttattttatatttaatagcacacatatatacggcatctttacccaacgcacagcttgtctgtcgttttgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatcctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI