Vellaria pellucidus

Order “"monothalamids"” > Family “Clade E” > Genus “Vellaria

Original description Gooday, A., J., Fernando, O. J., 1992, J. Micropaleontol., 11, 233-239
Further reference Gooday, A., J., Anikeeva, O., V., Pawlowski, J., 2010, Mar. Biodiv., 1-14 (1.04 MB)
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

Transparent test with reflective highlights. Outline varies from globular to elongate. The apertural end is drawn out into a delicate but clearly developed, broad tubular extension with a flared termination.

Representative pictures

Vellaria pellucidus Vellaria pellucidus

Specimens

Specimen 10139

Species "monothalamids" > Clade E > Vellaria > Vellaria pellucidus
Isolate number 10139
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequences

SSU partial

>Vellaria pellucidus | genomic DNA | 10139.3 | sediment sample - Tile Hole | taxon:859217 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtggtttctccctcgttggagtttccactataaatatgctagtcccttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcctaattgcgtttcacaaagagctttctaacttccatctgttgcgcgttgcacttcggtgcttcgtcgcacggtggagaaaaagctctgaaggcgacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatggttgtctgtttgcttcggcatcaggcttcctgcacggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttacaagactcgagtttggtgttttgtacttcggtacgttacaccactcggtcactgacctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatctcatgtttgtagccgtgctttcagcttgtctgtcagtattgtttgttaccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagctatttatagcaagctatggaaatctacgcgaacagcgaggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Vellaria pellucidus | genomic DNA | 10139.2 | sediment sample - Tile Hole | taxon:859217 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtggtttctccctcgttggagtttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagagctttctaacttccatctgttgcgcgttgcacctcggtgcttcgtcgcacggtggagaaaaagctctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatggttgtctgtttgcttcggcatcaggcttcctgcacggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttacaagactcgagtttggtgttttgtacttcggtacgttacaccactcggtcactgacctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatctcatgtttgtagccgtgctttcagcttgtctgtcagtattgtttgttaccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagctatttatagcaagctatggaaatctacgcgaacagcgaggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10165

Species "monothalamids" > Clade E > Vellaria > Vellaria pellucidus
Isolate number 10165
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequences

SSU partial

>Vellaria pellucidus | genomic DNA | 10165.2 | sediment sample - Tile Hole | taxon:859217 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtggtttctccctcgttggagtttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagagctttctaacttccatctgttgcgcgttgcacttcggtgcttcgtcgcacggtggagaaaaagctctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatggttgtctgtttgcttcggcatcaggcttcctgcacggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttacaagactcgagtttggtgttttgtacttcggtacgttacaccactcggtcactgacctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatctcatgtttgtagccgtgctttcagcttgtctgtcagtattgtttgttaccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagctatttatagcaagctatggaaatctacgcgaacagcgaggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Vellaria pellucidus | genomic DNA | 10165.1 | sediment sample - Tile Hole | taxon:859217 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtggtttctccctcgttggagtttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagagctttctaacttccatctgttgcgcgttgcacttcggtgcttcgtcgcacggtggagaaaaagctctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatggttgtctgtttgcttcggcatcaggcttcctgcacggagtttttgcaaactagagggaccgctgacaacttttaaaatagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttacaagactcgagtttggtgttttgtacttcggtacgttacaccactcggtcactgacctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatctcatgtttgtagccgtgctttcagcttgtctgtcagtattgtttgttaccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagctatttatagcaagctatggaaatctacgcgaacagcgaggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10167

Species "monothalamids" > Clade E > Vellaria > Vellaria pellucidus
Isolate number 10167
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequence

SSU partial

>Vellaria pellucidus | genomic DNA | 10167.1 | sediment sample - Tile Hole | taxon:859217 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtggtttctcccttgttggagtttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagagctttctaacttccatctgttgcgcgttgcacttcggtgcttcgtcgcacggtggagaaaaagctctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatggttgtctgtttgcttcggcatcaggcttcctgcacggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttacaagacttgagtttggtgttttgttgcttcggtaacgttacaccactcagtcactgacctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatctcatgtttgtagccgtgctttcagcttgtctgtcagtattgtttgttaccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagctatttatagcaagctatggaaatctacgcgaacagcgaggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10168

Species "monothalamids" > Clade E > Vellaria > Vellaria pellucidus
Isolate number 10168
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequences

SSU partial

>Vellaria pellucidus | genomic DNA | 10168.3 | sediment sample - Tile Hole | taxon:859217 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtggtttctccacttgttggagtttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagggctttctaacttccatctgtcgcgcgttctttcacttccgggtgtttgagctgtcgcacggtggagaaaaagctctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatggttgtctgtttgcctcggcatcaggcttcctgcacggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttttacaagacttgagttagtgttctgttactcgttaacgttacactactcagtcactgacctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatctcatgtttgtagccgtgctttcagcttgtctgtcagtattgtttgttaccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagctatttatagcaagctatggaaatctacgcgaacagcgaggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Vellaria pellucidus | genomic DNA | 10168.2 | sediment sample - Tile Hole | taxon:859217 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtggtttctccacttgttggagtttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagggctttctaacttccatctgtcgcgcgttctttcactttcgggtgtttgagctgtcgcacggtggagaaaaagctctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatggttgtctgtttgcctcggcatcaggcttcctgcacggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttttacaagacttgagttagtgttctgttactcgttaacgttacactactcagtcactgacctacttcgaaagtaagtaggcaatcaattcgaagtaatgatttccttttcgcacatacttatatctcatgtttgtagccgtgctttcagcttgtctgtcagtattgtttgttaccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagctatttatagcaagctatggaaatctacgcgaacagcgaggtctaaagggaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Vellaria pellucidus | genomic DNA | 10168.1 | sediment sample - Tile Hole | taxon:859217 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtggtttctccacttgttggagtttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagggctttctaacttccatctgtcgcgcgttctttcacttccgggtgtttgagctgtcgcacggtggagaaaaagctctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatggttgtctgtttgcctcggcatcaggcttcctgcacggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttttacaagacttgagttagtgttctgttactcgttaacgttacactactcagtcactgacctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatctcatgtttgtagccgtgctttcagcttgtctgtcagtattgtttgttaccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagctatttatagcaagctatggaaatctacgcgaacagcgaggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 10169

Species "monothalamids" > Clade E > Vellaria > Vellaria pellucidus
Isolate number 10169
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequences

SSU partial

>Vellaria pellucidus | genomic DNA | 10169.1 | sediment sample - Tile Hole | taxon:859217 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtggtttctcccttgttggagtttccactataaatatgctagtcctttcaggattgtgtgataggtggtgcatggccgctcttagttcgtggagtgatctgtctgcttaattgcgtttcacagagggctctttaatttctatctgttgcgcagcacctcgttgtgtttgtcgcacggtagatcaaaaagccctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatggttgtctggttaacttcggttccaggcttcctgcacggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttactaagactcgagtttgtgtttagtgcttcggtactttacacagctcggtcaccgacctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatcccatgcttgcatccgtgctcttggcttgtccttgagtattgtttggtgccttgggatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtccttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagctatttatagcaagctatggaaatctacgcgaacagcgaggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Vellaria pellucidus | genomic DNA | 10169.2 | sediment sample - Tile Hole | taxon:859217 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Vellaria | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgattgtggtttctcccttgttggagtttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacagagggctctttaatttctatctgttgcgcagcacctcgttgtgtttgtcgcacggtagatcaaaaagccctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttataaaacatggttgtctggttaacttcggttccaggcttcctgcacggagtttttgcaaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaattttactaagactcgagtttgtgtttagtgcttcggtactttacacagctcggtcaccgacctacttcgaaagtaagtaggtaatcaattcgaagtaatgatttccttttcgcacatacttatatcccatgcttgcatccgtgctcttggcttgtccttgagtattgtttggtgcctgggatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtccttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtatagaggactggctagctatttatagcaagctatggaaatctacgcgaacagcgaggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI