Leptammina flavofusca

Order “"monothalamids"” > Family “Clade C4” > Genus “Leptammina

Original description Cedhagen, T., Gooday, A., J., Pawlowski, J., 2009, Zootaxa, 2096, 9-22 (1.76 MB)
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

Thin and finely agglutinated test wall, cell body is yellow-brownish in appearance. Round aperture with well developed peduncular sheet.

Representative pictures

Leptammina flavofusca Leptammina flavofusca

Specimens

Specimen 5174

Species "monothalamids" > Clade C4 > Leptammina > Leptammina flavofusca
Isolate number 5174
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4526m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -70.31, -14.34

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 5174 | depth 4526m, using a vegematic boxcorer | taxon:558411 | 1 | Antarctica:Southern Ocean, Weddell Sea | 70.52 S 14.58 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttctttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccctagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtcttttgtgagcctkgtatttctttttttagtttatacatctcagttngnctkcgttttatgggagtgtgtttgtctttttatatttattccgcttttngcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgntaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtcyaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 5174 | depth 4526m, using a vegematic boxcorer | taxon:558411 | 3 | Antarctica:Southern Ocean, Weddell Sea | 70.52 S 14.58 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttcttttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggkgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccacatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagcttgtatttctttttttagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 5226

Species "monothalamids" > Clade C4 > Leptammina > Leptammina flavofusca
Isolate number 5226
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4696-4698m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -64.58, -43.0197

Barcode sequence

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 5226 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 1 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttcttttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacraacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagcttgtatttctttttttagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 8352

Species "monothalamids" > Clade C4 > Leptammina > Leptammina flavofusca
Isolate number 8352
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4696-4698m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -64.58, -43.0197

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 8352 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 4 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttctttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtccttttgagcttgtattgctttttctagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattagtgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 8352 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 1 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttctttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagtttgtatttctttttttagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgcgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggagtgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtctgagggactgggttgcagttttttttatattctgcaaacacctgcggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

Specimen 8353

Species "monothalamids" > Clade C4 > Leptammina > Leptammina flavofusca
Isolate number 8353
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4696-4698m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -64.58, -43.0197

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 8353 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 9 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtgtcttttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggkggkgcatggccgttcttagttcgkggagkgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcgcacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagcttgtatttctttttttagtttataaatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgnacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 8353 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 8 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatctttccgggtccggacacactgaggattgacaggcaattattgctaacagtgtcttttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagcttgtatttctttttttagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI