Syringammina corbicula

Order “"monothalamids"” > Family “Clade CX” > Genus “Syringammina

Original description Richardson, S., L., 2001, J. For. Res., 31, 201-209
Further reference Pawlowski, J., Holzmann, M., Fahrni, J., Richardson, S., 2003, J. Eukaryot. Microbiol., 50, 483-487 (75.9 KB)
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

The species is characterized by its epibenthic habitat and the unique basket-like depressions that rim the periphery of its hemispherically-shaped test of anastomosing, agglutinated tubes.

Representative pictures

Syringammina corbicula Syringammina corbicula

Specimens

Specimen 2270

Species "monothalamids" > Clade CX > Syringammina > Syringammina corbicula
Isolate number 2270
Collector Susan Richardson
Identifier Susan Richardson
Collected on May 2000
Habitat soft sediment
Depth 3106m
Location Atlantic Ocean, off Cape Verde
Latitude, Longitude 18.27, -21.01

Barcode sequence

SSU partial

>Syringammina corbicula | genomic DNA | 2270 | taxon:212475 | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcaatcatgtgaaatgtttctaacttttacatataaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacataggacttaaactcaagtgtgctacatttcttgtacttattatatgtaaatttgatataatatatatatgtgttataaaaatgattgtaatataaaatttactttttatataattttcattaagtatatataatatttttacaattattactaaatatttactattttgaaattgtacgtacacattaggtcctgaaagcaacgaacgtgaccgcatcctcttgttgccttttactaaaacgagtatcttaaaaattaatattttttattaataaattatctacaagttttgaccagaaagtgctttatcaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtaagcatctcattttataatgctgtatcatcatcaatctttttaaaagttacttgatttagttgaacagtaaagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttctcttaattcaatattgtttgattttgtgagcacacaatatgctgctcctttccctggcagttagcttttttggtctttctgtctttcagtgagttaggatgtttctcagcatgtgctttttgtcaattcttggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgagtaccttgcttttttgaagttattaccacttatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacc

See sequence on NCBI