Psammophaga magnetica

Order “"monothalamids"” > Family “Clade E” > Genus “Psammophaga

Description Pawlowski, J., Majewski, W., 2011, J. Foram. Res., 41, 3-13 (2.55 MB)
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

Elongate organic test withtransparent reflective wall. The cell body is white and transparent with fine granules and numerous mineral particles, which are concentrated at the apertural end. A great majority of the mineral particles consist of magnetite and titanoferous magnetite.

Representative pictures

Psammophaga magnetica Psammophaga magnetica

Specimens

Specimen 2112

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 2112
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1999
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 2112 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Explorers Cove | 77.58 S 163.51 E | Nov-1999 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaaccaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggactcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccactcggaatatgtccctgccctttgtacacaccgcccgtcgctcttatcgatggacttctctatgagtttgggggactggctttctatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 2114

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 2114
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 1999
Habitat soft sediment
Location Antarctica, Explorers Cove

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 2114.5 | sediment sample - Tile Hole | taxon:860578 | Antarctica:McMurdo Sound, New Harbor, Tile Hole | 77.34 S 163.3 E | Nov-2001 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtcgcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaacttttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgccttgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattacagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccacgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgttggacttctctatgagtttgggggactggctttctatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 2976

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 2976
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 2001
Habitat soft sediment
Location Antarctica, McMurdo Sound

Barcode sequences

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 2976.7 | sediment sample - Tile Hole | taxon:860578 | Antarctica:McMurdo Sound, McMurdo Station | 77.51 S 166.65 E | Nov-2001 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgatgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgccttgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattggtggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttccatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 2976.6 | sediment sample - Tile Hole | taxon:860578 | Antarctica:McMurdo Sound, McMurdo Station | 77.51 S 166.65 E | Nov-2001 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagtcgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattggtggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttccatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 3183

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 3183
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 2001
Habitat soft sediment
Location Antarctica, McMurdo Sound, Gneiss Point

Barcode sequences

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 3183.1 | sediment sample - Tile Hole | taxon:860578 | Antarctica:McMurdo Sound, Gneiss Point | 77.23 S 163.39 E | Nov-2001 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtcgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgccttgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccacgcttgtcgtgtggttttgttctgccttgatatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 3183.12 | sediment sample - Tile Hole | taxon:860578 | Antarctica:McMurdo Sound, Gneiss Point | 77.23 S 163.39 E | Nov-2001 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagccctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgggcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattggtggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttccatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 3183.11 | sediment sample - Tile Hole | taxon:860578 | Antarctica:McMurdo Sound, Gneiss Point | 77.23 S 163.39 E | Nov-2001 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgatgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgccttgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattggtggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttccatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 3184

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 3184
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on November 2001
Habitat soft sediment
Location Antarctica, McMurdo Sound, Gneiss Point

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 3184.3 | sediment sample - Tile Hole | taxon:860578 | Antarctica:McMurdo Sound, Gneiss Point | 77.23 S 163.39 E | Nov-2001 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattggtggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttccatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 3790

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 3790
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on January 2003
Habitat soft sediment
Location Antarctica, Ross Sea, Terra Nova Bay

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 3790 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Terranova Bay | 74.4 S 164.04 W | Jan-2003 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtcgcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 7763

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 7763
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 20m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.1, -58.37

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 7763 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.1 S 58.37 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtngcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattrttgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgaggttgagggactggctttctatttat

See sequence on NCBI

Specimen 7776

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 7776
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Location Antarctica, King George Island, Admiralty Bay

Barcode sequences

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 7776.3 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.1 S 58.32 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtctagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagttatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttat

See sequence on NCBI

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 7776.2 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.1 S 58.32 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccacgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggtacagacattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttat

See sequence on NCBI

Specimen 7784

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 7784
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 17m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.1667, -58.4167

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 7784 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.1 S 58.32 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatnagtttgggggactggctttctatttat

See sequence on NCBI

Specimen 7790

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 7790
Collector Jan Pawlowski
Identifier Jan Pawlowski
Habitat soft sediment
Depth 17m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.1667, -58.32

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 7790 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.1 S 58.32 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttat

See sequence on NCBI

Specimen 7887

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 7887
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 107m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.09, -58.34

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 7887.1 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.09 S 58.34 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaagtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctttatgagtttgggggactggctttctatttatagncagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 7918

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 7918
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 17m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.1, -58.32

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 7918 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.06 S 58.19 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA cttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccgcgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttat

See sequence on NCBI

Specimen 8010

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 8010
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 108m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.09, -58.29

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 8010 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.09 S 58.29 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctcgtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccacgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttatagacagctatggaaacctaaacgaatagtgtggtctaaaggaaagagaagtcgtaacaaggca

See sequence on NCBI

Specimen 8149

Species "monothalamids" > Clade E > Psammophaga > Psammophaga magnetica
Isolate number 8149
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 30m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.04, -58.21

Barcode sequence

SSU partial

>Psammophaga sp. JP-2010b | genomic DNA | 8149 | sediment sample - Tile Hole | taxon:860578 | Antarctica:Admiralty Bay, King George Island | 62.04 S 58.21 W | Mar-2007 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttagcatctggcttcggttagctctgcttttctactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttacctgttgcgcgtcactgcgctctctgagacggtgtctgtgcacggtaaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttttttcaaacatgagagtactgtcttgcctngtgtgagctgtgcttctctgcatggagtgctaactagagggaccgctgacaacttttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactaaaaaaagctcgagtttgtgtttagttgcacttgtgtaactttacatagctcggctactgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcaggctagcccacgcttgtcgtgtggttttgttctgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttgggggactggctttctatttat

See sequence on NCBI