Shinkaiya lindsayi

Order “"monothalamids"” > Family “Clade CX” > Genus “Shinkaiya

Original description Lecroq, B., Gooday, A., J., Tsuchiya, M., Pawlowski, J., 2009, Zool. J. Linn. Soc., 156, 455-464 (610 KB)
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

Large xenophyophore, at least 8cm in diameter and 5cm high. Fragile more or less cylindrical test forming tightly-meshed reticulated structures composed of bar-shaped elements

Representative pictures

Shinkaiya lindsayi Shinkaiya lindsayi, microscopic view of fragment Shinkaiya lindsayi, microscopic view of fragment Shinkaiya lindsayi

Specimens

Specimen 9264

Species "monothalamids" > Clade CX > Shinkaiya > Shinkaiya lindsayi
Isolate number 9264
Collector Jan Pawlowski
Identifier Beatrice Lecroq
Habitat soft sediment
Depth 5435m
Location Japan Trench off Sanriku
Latitude, Longitude 38.14, 147.0

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggatatactgaagattgacaggaaataatgattagtttttaaactcttacatttaatttgctggtcctttcataatagtatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgtgtaggacttaatactcaacagtgtgctactttacaatacccttggttgttgtgaaatttatctgtagtgagggttttcgcatattgatatattttttgagtaagtacatcttaagccctgaacgcaacgaacgtgaccgcaaccctttgtaactaccttttggaaaattgcgcctggatttttttcaggtttttgtgattagctaacttaggggactgctgcgatttcttttaaaccagaggaaggatgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattattgcagtgagcacctcatttaataaaactgatcataagatcgaaagattttttattggtcagaatgggcctgcctcgaaagagtgtaggtaatcaatacgaagtaatgatttctctgattacaaattttatttgtttttgatagcacacaatatgctaacgctatatctctgaatattagtaaaaatattttttgttgacttttttgtttaaagtggcaaatttatatttttgaaatttggtgtgttatagttttttagtatgtgctttttgtcaactcttggtggggacagaccattgtaaattgttggtctcgtcttaactaggaatgccttgtacgggttttggtttaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttaagggactaatatgatttcattatagaaacttaaacgaacagtgcggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Shinkaiya lindsayi | genomic DNA | taxon:525825 | small subunit ribosomal RNA ctcaaagattaagccaagcaagtggctatgataacccaacagtttaaataagtgattatttattcgaattttttaaagttttgttttacaaagcgtttattcatttatgcaactgcaaacagctgcttaatatagttacacttgtcttgacttggcgttcatatttgtataattttttatattgatattagatattaatttgatttctctgtaacattttttattgttataattttaaatttttaaaagttttggataactcagggaaagtttggctaatacgtacgagaattaatatttttgatattcataattatgtttttttggtgtatatttttttaaagtatatttttgtgttgttaaatattttgattgtgatattttctatataatactgtgattattttttgtctttaaatttgtttgaggagacaaattaatttgattattgataaagatttaggtattaatggtcgacacctaggattttattagttttagctgtcgagcatttgtgataatctttgttttttaatttttaaagattcaaacattcaaatagttttaagaaataagaaatatgtatttctagattgttgtaaataatatcgtgtgtaatcataaatatatgaaatataatttaatataaaatatagtttgatctgaattgatattcggattttttgttgttaataattgtggattttttatgtcttcagcacttatcggtaaatttttattgaaatttaatagctacgtgaaatgacgataagtacgcgtgtatttaatatgtgtttacatatattgattacaacattgctgagcagactttgcgaagtgaaaatctaagcgaagcatgtcatacaagcatctagagcatcaagtcaccgggttggcaagtgtatttttgaaccttcaaagcaataacgcatacggaagagtagtttctgatcccatagaaggagcaaagtccattgagagatcgctcttagttctaaggaacgcagcaggcgcgtaatttgcccaatgctagtaccctattattattagtattgtattgtaatttttttgtgataacgtatatgcatatgcgttattactagtgttaatgattttatccttgttttctatgtcgatgtaattataatataatttttttagttatttactgaggcagtgacaagctgtaatggttgagtataaataagacaaacgtataaattccaatcttgtttttagcaagttatttaacttttgcgttttgtgtactcaattagaatgcggtgagtttaaacaactcagaacctttaaatggtattagagattatctttagctatttatgtatctgaatttcaagtggagggaaagtctggtgccagcagccgcggtaataccagctccactagcctatacaattattgttgcggttaagaggctcgtagttggattgaacaaaattttaattttacggtaaacaagatttatgatttattttagtaaatcattttttgttataattgagtttgattgtattgtggtttgtcactaatctttaaatttgattatttatgttatatattttaaatcattttttgttataattgagtttgattgtattgtggtttgtcactaatctttaaatttgattatttatgttatatatttcaacactgtgaacaaatcagagtgcatcaaacatgtngtaaaagtgcaatgcatgaattatcatggaatgttgcatgttattagatgttttttggtgttttttaaatattatgaggagtggtacactagaaagtaagattgtcaaatgtaatttttttattttgtgtatatgaatctgtaagtttttttatgtgagtaaggttgtatgatatgatgtacgatttatatttaattgtaaggctttttgcttgctaaacagaattatatggagtaatatgtttgccgaaaccgtgaaagtaagccatagcgtgaaggtaatcattgaaatatgagtattcatttgaaaatgagctttattactatatacatttttttntggagtaaggttgtatgatatgatatgatatgtgataaatataatgtatgatacgatgtacaataaatataatcgtaaggctttttgcttaataaacagaattatatggagtaacatgcttgccgaaaccgtgaacgtaagccatagcgtgaaggctttattactataaatatttttttctggagtaatgttgtattatatgatctgtgatgaatatgattgcgtggtttttgcttgataaaagaattgtgtacgagtaaggctgtattatattatatacaataaacagaattgctaaaatattttaaaaatattnaaaatatctatgtcgatggggatagttggagtcaagagtactgcttggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcgcttgactaggctatactctttgtgttgtttttgattttatatattttatatttcatctaaatttcactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccatttgttacatcaaacgatgggctctcaattgcataagcattaagttgtttttgccctcaatctgcaaaatatttggtttgagcttgtgttaagtttaacacgctcactatttttcgtatggtttcgaaggacatttcatttatataatttcgttgcgtgtaagtattataatattacttgaaatattagtaatatgtgtctacacatgattgtttgagctttgcgctcatattattggtgagatgtaagcactagatgaacgtttgctgaatataagcagaaagttttttgttttttgttctagtataacttttgtcatgtataaagtgtgaagcacgcgttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaattcgcccttacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggatatactgaagattgacaggaaataatgattagtttttaaactcttacatttaatttgctggtcctttcataatagtatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcgtgtaggacttaatactcaacagtgtgctactttacaatacccttggttgttgtgaaatttatctgtagtgagggttttcgcatattgatatattttttgagtaagtacatcttaagccctgaacgcaacgaacgtgaccgcaaccctttgtaactaccttttggaaaattgcgcctggatttttttcaggtttttgtgattagctaacttaggggactgctgcgatttcttttaaaccagaggaaggatgcggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgattattgcagtgagcacctcatttaataaaactgatcataagatcgaaagattttttattggtcagaatgggcctgcctcgaaagagtgtaggtaatcaatacgaagtaatgatttctctgattacaaattttatttgtttttgatagcacacaatatgctaacgctatatctctgaatattagtaaaaatattttttgttgacttttttgtttaaagtggcaaatttatatttttgaaatttggtgtgttatagttttttagtatgtgctttttgtcaactcttggtggggacagaccattgtaaattgttggtctcgtcttaactaggaatgccttgtacgggttttggtttaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttaagggactaatatgatttcattatagaaacttaaacgaacagtgcggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI