Hemisphaerammina bradyi

Order “"monothalamids"” > Family “Clade F” > Genus “Hemisphaerammina

Original description Jones, T., R., Parker, W., K., Brady, H.,B., 1866, Monograph of the Paleontographical Society, London , 19, 1-72
Further reference Meisterfeld, R., Holzmann, M., Pawlowski, J., 2001, Protist, 152, 185-192 (547 KB)
Further reference Pawlowski, J., Holzmann, M., Berney, C., Fahrni, J., Cedhagen, T., Bowser, S.,S., 2002, J. For. Res., 32, 334-343 (123 KB)

General description

Hemisphaerical coarsely agglutinated test with yellowish-orange allogromiid inside, epibenthic mode of life, often attached to seagrass blades.

Representative pictures

Hemisphaerammina bradyi Hemisphaerammina bradyi, test partially removed Hemisphaerammina bradyi, test completely removed

Specimens

Specimen 1439

Species "monothalamids" > Clade F > Hemisphaerammina > Hemisphaerammina bradyi
Isolate number 1439
Collector Maria Holzmann
Identifier Maria Holzmann
Collected on June 1999
Habitat Sea grass meadow
Depth <5m
Location Mediterranean Sea, Banuyls, France

Barcode sequence

SSU partial

>Hemisphaerammina bradyi | genomic DNA | 1439 | taxon:159868 | 2 | single cell | France:Banyuls | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgagggttgacaggtgtttcgtaaagttaacggtttagtaattgtttgtgccttcacgggtatttgcttttattgggctttttcatttacatttcaaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattggcgtgagtgagttattatagttctttcgtgacctcattatttcatttaatatgttattttgattgcgtccggttctatatgcttgccatcgccacgaaggcaacgaacgtgaccgcaacctcttgttgcctcccttgagcattatagttgaaattctcaatttatttgagttatttctttatatttgccacagtcttataagtgattcttttatctttttttaaacggaaaggtatttgtaatttactatatgttttttactgcagtggagggaaactagagggaccgctgacatttcttaaaccagagaaggttgcggcaataacaggtctgtgatgccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatcttacccagttcgtgtgcacagttgcagctttaccatcaagtatgtttctttgtttttgtgcttggtgtttctcttaggagtatatcttgtgcatttgcattgtttcatgctggtaactctctgatgcatttgtttttatttagtaattattgcttagttgtagtgttgctttataatttttataactttaacgactaggctacttcgaaagtaagtagctaatcaattcgaagtaatgatttccttttatttttatattttatagcacaatttacatgtccatagtcttttataggtggcgccttgcgtgttgctttataatgctattgtttggcatgtgctccattaattcgtggtggggacagaccattgttaattgttggtctcgtcttaactaggaatgccttgtacgggtctttggttcaacagaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaagccattaagttatttatttagcttaataatttattctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI